Description :
From Genome Similarity Track
Location :
Scaffold_24:297276- 302349
Sequence
5073 bases(100 bases per row)
GACTCTCTGTTGAGATGGTTTGTTGAGCTGGATGAAGCCATAAGTGCTCTTCACATCGTCGATGAGCAAATGCAGGTCGCATTTTCTCCATCGAACTTGT
CCGGACGTGCCAAGACTTGGGCCTCGGGTCCCAAGCTACACGAACCATACAAAGACATATGTCTTTGGGTCGTTAGAAGTCTACAAGACACTACCTTGTC
AAACATTTGAACCGCCGCGAGCTGAGTTCAGGAATCCTCTGAACCTCTGAAACTCAAACAAGGCAAACGTAATATACACTCCTACATTCAGTACATACGT
CATCTTACGAGTTGCATCATGGACAATTCGCCGAATGAACAAACGTCGATCACGTTGTTCATGCAGGGTCTGACGAAAATCCAGTCAGGACCAACCTCTT
CTACTAAAATCAATACCCTGGAAGAGGCAATCCGGATTGCGGAACAGGAAAAATTTAGCGTGAAACAAGCTCACGTGATTTCAAATTCCTATCACCCCCC
GAGGCTAAAGGGAAATGGAGGCCCAGAACCGATAGACCTATTTTACGCTGAGAGTGAAAGCTCTCGCATTTCCAATTTAAAGAAGTTGCAGACATGCAAT
AGATGTCAAAAGACAGGGCATTATGTATACAAATGCAGTAACACGAACGCGGTACCACGCACCGCAGGAAACAGTAACCTTCAAGCGGCCAAGAAGGGTC
CGAGGCGTGGGTCCGACGCTGTTGCGAAAGCGAAATGTCGCAACGGACAGCAAAAAATGTTCAAGGTTAGTAGGTGCGGAGCACCCTACTGATCCATCAA
CGTCAAGTGAATTTTCAGGCCTCTTGACGAGAACTGCTCCCAACACTCAGTCATTGTGTGTTGCTGCTTCTGGTAATGAGGTTTCCCTCATCACCTTGAA
ACTCTACGTGGCAGAGGATATGTCACTACGAGCCCCAGTCGATTGTGGGGCGCCAAACAACTTTGTAAATCGCCAATCGCTAGACAATAGCAAGCTTAAA
TATTTTGAGCGAGAGATGTCTCCAACGAGGATGACGGTACGCGACAGGCGCATCCGTAACATTGATAAAACATGTTGTGAAAATTACCTATTCACTGAAA
GAAGTCGAATATGACGATAACTTCATCATATTGGAATTGGATGACAAGTTTGATGTGATCCTTCTTTTACCGTGGCTCAGAAGGTACAAGCCACAAGTCA
GCTGGTATCGACGAACAGTCAATATGGCTGACTCTTGTTCACCAGAAGGCCATCTGATGAACGTCTTGGATTTTACACCTCCATGTAAATGTACTACGAC
TGATTGCGATGGCCTCATGTGTGTTTTGGTCGTTAGTACGACGGCACAAGATTGCGATGTGAATAACCATCACACTACGGAGCAAATTCCCGGCGACTGT
ACAGGCACAGTAAGCGCCGAAGGGCTACTACTCGAATAAGTCGACCGGAACGGGGCGCGTGTGTCCTCTTAATAGACAAGATCCAGAGAATAACCAAACG
ATTGCCAATTAGTGGAAATACGAAGATCCTAGATCGATTAAAATATCGAACGTAGAGGAACTGGCTGCGGTAGCGCAACCACTGCCCGAAGACACCAAAG
GAGCTATTCCCCGCGTGTCTGAAGACGAGTTAGCCCAAAAGGCTAGAGTTAAGGGAATAAGTCCCCAACAGACTGTGGAAATCAGTTCCTATGAGATAAA
AGAGACATGGAATGTCCTGGTGAATGAAGGATCGAGTATAGGTTTTTGTACACTTGATCTGATCGCTCCTTTGAAGTTAACTGCGTATATCGCTCAGTTG
CTCCTGCCGAACCAAAAGAGATTCTTGCATGATCTGCGTAGTGACAAAGGCAAGCAAATCTGCGTACTCGTCGCGGAAGACGAAAACGTCAGTGATACCT
GATCGGCAATGGTCTTTGCATAGGATGAAAGAGTTCTCAGTAGCTTATCAATGAACAAGAGTGTCCATGATGAGAAGACTCGGATTAAGCGATATACATC
CCACTCGTGGTAATCACTTTAGGCAAACCCTCTTTATAATGATTTAATATAATCCAGGAAAGTGTTCCCAGAAGCAGTGTCGTGCGGATTACCTAAGGAC
AAAGGTACTCGTCACGATGTCGACCTAAAACGGGGTTTGAAGTACTGTGTCATGAAGTAATGGCCACTGCCTCGTGAACAAGTACTAGCGATCGACAAAT
TATTCGCAGATCGCTTAGCAGCCGGTCATGTGAGGGAGTCGACCTCCCCACATAGCTCTCCGACCTTCTTTGTACGGAAATTTAGAGGAGGATGGCGGAT
AGTACATTCCTCCAACAAGCTAAATGCTTCAACTGTACCGGCTCAGACGCCGACACCAAGAAAAGAGGTTATCATAGATAGTATGGCAAAGAGTAGAGGA
CAGATGTCATCATAGATGGTATGGCAAAGAGTACTAAAGGAAATATGTCATCATAAATTGTATGTCAAATAGTACCACATTTTCTTCAATGGAAATGATG
AGCGGATTCTATCAACTCCTTATGCGCGAAAGTTACATTCCATTTACTGTAGTGATCACCCCAAGCGGTATGCTTTAGGAGTGGTTAGTAATGCCACAAG
GGCTAAGAAACACCCATGCCACATTCAACAGATGTGTGACGCATCTGTTGAGATCTGTTCGAGAATTCGCGCCCAGATACTTCGATGTTGTGTTCGTCCA
TAGCCGAGCTATGTACGGACAGACGGATTTAGAACTTCACCGACTCCACGTCCTGAAGTTTCTTGCACTTACGCGCGATCATAAGTTGTACGCCTACCTC
AAGAAGTTCATATTTGATGCTATTTAAAATACCACTCCTTGGTTGCATTGTGGGTAAACATGGCTTCCGGCCCGATCCGGAAAAGATCAAAGCGATCACC
GACTTGCCGGTGCCTACAGATGTCAAGGGACTTCGAAACTTTCTTGGCCTAGCGGCGTAATTGCACAAATACTCGCACAAATACGCCGAGATGACTGTCC
ATCTCTCTCGTTTATCGAAATAGAAAGCGAAGTGGGTATGGAGTGCCGACGGTCAGCGCTCCTTCGAGGGTATCAATAAAAACTTGATATGATCGCCAGT
TTTGGCAATCGCAGACCGTGAAAGGCCATTTCATGTGGTCTGTGATTCCAGTGACTTTGCAATCGGCTGTGAATTAATGCAGTACGATGAAGAAGATGCG
TACGTGTCGTTTGCTATCAGTCACACCACCTGCAACCAACGGAACTCGAGTACCCCGTCCATGACAAGAAACTCCTTGCCATGAAGTACGCGCTGGATAA
ATTCAGAGTCCATATGCTAGGCGATAGACCTTTTATCGTCTATGCGGACCATGCGTCTTTACGCACGGCTGTAAACAGTCCACACGTCTCGCAGCGGATG
GCGAGGTGGCTGTCATTATTTGCGGAGTACAACTTTCCGTCGAGTATAAGCCAGGACGACTTAAGGTTGTCCCGGACGCGTTGTCGCGACGACCCGATTT
CGAGTCGGCTGTACAACCCGACACTGGTCCAACCACTGACGGGGTATTGACTTTACGTGTTCCGTCGTCAACCTGATTGGAAGACATGCGAAAGGCGTAT
GGTCCAGAGATAGTGCATTTGATGTATTTTCTCTCACAACCATCTGGGAAGAGCCTAAAACAGTTATCGACAGTATGTCGAACCTCTAAAGAATTATACA
GTTCGCAACGGCTTACTAAAATACTCAGCTGTTGCCGGCGACACGCCTCGTGTCGTCGTACCAAATACTGGTGATCTTCGATACTTATCATGTACGAGTA
CCATGACGCACCTGTTGGTGAGCATCGTGGTCGAGAAAGACGTATCTCACAGTGAGCGGCGATTGTACTGTCCCCGCCAGTATCAGTTCGTTCGCAAGTA
CGTTCGAACCTGTGAGGTATATCAACGGGTGAAGTCTAGTCTTTCCGTTCGTGCCCCTTTACATGCTTCCCGTCCCAGCATAGTGCTGGATTCCGTTTCA
ATGGACTTCGTCTTCGGATTCCCCGCAGATCCCCTCAAGAATACTGGTATTCTAGTGTTCGTTGACAGATTCAGCAAGATGGTACATATCGTTGCTGTAC
CTGAACCAATCAACGCATCGTCTTGTGCTCTTGTCTTTATCGATATGGTCTTTCGCCTTCATGGGCTGCCTTGTGGACTCGTGTCCGACCTAGACCCGCG
GTTCACATCCGAGTTCTGGCGTTCCGTGTTCAAAACACTCGGAATGCGCTTTAAGATGTCTATATCTTAGACCAACCTAAAACTATAATCAGACAGAATA
CGCCGATCGTGTCCATGAAGAGATAATTCGAGGGTACGTCCATTCCTTTACGAATTGGAGCGGATTCTTGCTGATAATGGTTTTCACCATCGACAACTCG
GTCCACGCGTCGACGATGCATACGCCTTTTGTAATGGCTTGCGCCATCCGCGTCTACTCACCTTTTTAGAGTGTGAATCTAGTTTAAGGAAGGTACTCAT
TCGAGCGAACGCCAACCCGGCTCTCACTCGTCATGTGCTGACGATGCGGTCACCACGTTCGACGCCGATGTCGATCACATCGACTTCGGTGAAGAAGAGG
AAAGGAAGAGCGATGATGCTCTTACTAACCACGATACTGATTAAATTAGCATCACGCCCAGTGAGTCCGAAGACACACTCGCTGATGCGACAAGTTATCT
TTCTGCAGTGCACTCCAAGAGCACTGTAGCTAAAGAAAGCGAGTCAGCACATGAAATCAATGCTGGCTCGCAAAACGTTTGTCCGTTTCGTACAAGACAC
TATTGCAGAAGCGGTGGATCGACAAAAGAGAAACGCTGACAAGAATGGAAGGAAAAACCTTCTTCTTATATTGAAGGTGAAACAATTCTACTATAGGCTT
ACCACGACACACAGTGACTAACTTGGGTAGTAACAAGTTACTATCCAATCTCATCAGTCCATTTTAGTGTGCTGCGCCGCCTAGGTAACGCAGATACGAT
TAAACTTCTACTGTATATGTGCACACATCCTACGCTCTGCTTTGGTCACCTCAGGACGTACTACCAGTACGGG