Description :
From Genome Similarity Track
Location :
Scaffold_10:29726- 32822
Sequence
3096 bases(100 bases per row)
CAGAATTTCATTCCTCCCATCCAACAGCAGCACTCCAGGAGCCCCAGTGTACTTTGACATCGTTCTCAAGCATTCCAAATCAGGTAGCACGGGGTGCGTG
GTGCGTCAGAACGCTCGCCTCGTGACGGTGCCGCACGTAGGCGAACCGCAAGTGGCTACACCTTATGTATACAGTCAAAAGGTGTACGAGAACGCGTTCG
CAACCATTAACATCCCGCTCATCCAAGTCGCAGATCAACTGAAGGAGTTCATCGAGCTGAAGATACAGTCGAATGTGAGCTCGCTCCACTTCCAGGTTCA
AAGCAACGACAGCACCGTCGCAGTGGTGGGCAACGCTACAAGTGCAACAGGTTTAACAACCGTGATTCTCCAGCGAAGTGATCTCCAGCATCAGATCGAA
CGGATGGTGGTTCAAATCACTCCTGGTGACGACTTCGTTGGCATTGTCCAGTTCGATATCGAGGTGACTGCGATTCACGGCAATGCAGTAGAGGTGGACG
ACATCGAGGAGTATTCTAGTGAGTATATCACGATTTACCAAGTTGTGCTCGAGTGGTTCGACAGTGCGTCTTTCACGTCGATTCAGCCGAACCCACTGGG
GACAGCAGTGTACCGGAGTATGCCCATGCAACTCCAAACGAGCGCGACTTTGTCGTTCAGCTATCGGCTATCGTCAGGTAACGTGACATTGTCATGGGGG
GTGCCCTTACGTTTTGCCTGCTAACTCTGTCTATCGTGCTCTCGATCAGCATTCTCGACTTTGAAGACCGAGGTACTGCTCAATGAGACCGAGCGACGAG
TACTCTGGTCAAGCAGTGCTGATTCATTGTATCCGAAGCAATGGAGCAACGTGGAAGCTGTCATCTCGATCCTGTTTCCGTCGACTGTCGAACTCAGCTT
TTTCGGTGAGGTGGATGCTAGTGACTTAATGTCCCTAAAGAGCATTGCGATTGCCAACTCTATTCAGCAAAGCCGCGTTGGAGAGCTCCAACTGGAGCAT
GCAACTGGCGGGATGATAGCGATCAGAGTACATAGCGTCATGGCAATTCCAGATCCAGTATTTTACAAAGTTCAGATGAAGCAAAGCGACGCGGTGCTTC
CATCTGCAGCTGTCTATGCGGGTACAGAGCGCTATGTAGGTTGATTTGCTTGTACTCTTTCGCAGTTCACTGACGATGTCCTCATCACTTATGTTTCGTT
TTCTCTAAAGGACCGGGAGTCGAATACGACGGCTGCTATTCTCCAAATACACTGTACAAGCTCCCGCTCACTCTAGAAGATACAGCGGATCTGAGTCCGG
TCACCCCGGCGCATTGCGGATCACTCTGCTCGTACCAAGAGTCTCAAGCTCGCTTTTCAGCCATCTCAAAAGTGCAGAGCAAGCAGGTATTTCCAATGCC
TCCGAGCGAATTCACACTTGAGTTTTGGCTCTACCAAGCAGTGAGCGCTAGCGTTGTCACAAGCAGGCCGCCCCAAGTCGTGATGGTGTACGGATCTGTG
AACGCGAGCATGCACGTGACACTCGACAGAGTCTTCACAATCTGGAGATGCAACCATTCACTGGTGCTACCGTTCGGGCTGCCCAGTCGCGAGTGGACCC
ACATGGCGTTATCGTTCAGTGCCAGCAGTAAGATCGGCTTCTTTCTAAATGGACGAGTGGCAGCGGTGGGTGTGTTGAGCACCTCGGGTTGCGAACTTCC
AAGCTCAGCAGTCTTTCAGCTAGGACGAGGTATGGTTGCAAATTGCTGGTGAACGACTTGCTCGGTTACTGACACTCCCTTTGGAAACCTGCGTAGACTC
GATGGAGATCTTGCCCACAAACTCAACTTCTTACTTCGACGGCAGCATGGACGAGGTACGATTTTTTGCAATGCAAGTCCTTCGGGTGTACTTCACATGA
TGGATACTAAGCCATTTTTGCAACCTTTATGATCTTGGACAGATTCGTGTTTGGTATGGAGCTCGACAGGCAAGCGACATTTTCAGTTGGTTCAAGTCCA
ACATTGTCGAGCCCGCAGAGATGGTGCTGCTGTTAAGATTCAACCAGAAGAATAGGACTAGTAGCCTACTATCTGGCGGCGATGAAAGTGGGAATGGCAA
CCATTTCGTTATACGAGGGGTGGGCACGTCGCAGCAACTTCAAACGCGTTCGTTTGGACTCGCGGGCGATGGATCGTGTTACTGCAGCCAATTTGCTGTC
CCAACCTCCTCTGCGCTCGATCCCAATGTATGCGACCGTCAGTGCGGCGACGGCAGCGCTCAAAGCTGTGGGTCCATGACGACATCTCAAGCCGTGAGTG
TGTACACTCGTGGTGCGATTCAAATCGGCAGTCTCGCTTCCAACACCGAGTACGAATTTACCGCAACATTTGTGACAATCGACGGCGACGAGTTCGACAT
CAATCAACCGCTGGTGGCTTCGACAACAAGCCCAACGATCCCAAGCCGCGTGAACTACCTCAGTGTCGTTGAACACCAGGGAAAGTATGTAGAGCTCCAG
TGGATGGCTGTAGAAGATGATGGTGGCGCCCCGATCCTCAAGTACCAGGTGTTTGTGAACGGATACCTGGCATTTGAAACAGCGAACGGAGATACGCACT
CGGCAGCTCTCGACAATTTCGACCTCCTGCCAAATTGCACCATTACAGTCTGTGCAGTAAACGAGCTCGGTGCTGGACCACAGCGGATGCTGGTGACGTT
ATTGCCGGCGGATTCTAGTCTCCCCTCGACTCCGAAGCCGCTGGTTCCGATCATCGTCACAGGCGGCTCGGTGACATTCAGCACAGAAAATGTCACGTCA
ACTGTGACGTCGACCAACGCAACAGCTATACTGATCATCCAGCAGCGCGAATCGTCGCTTCGACAGTTTACAAACTCGATCACGCGAGTCAACGGATCTC
AAGTGACTGTGTACAAGCTCCGCTACGACACCACGTACGTCTTTCGTACGTATTCGATCAACGAAGTGGGCTCGTTGAGCCCGTTCAGCGCTCCAGTGAT
CGTTCAGACCAGTAAACTGAATGCACCTGGCAAGACTCCGACGCCAATCGTGACCCAAGTGACAGGTGGTTCGATATCAATGCTCATGACCGAGCC