Description :
From Genome Similarity Track
Location :
Scaffold_9:297259- 306219
Transcript NameFunction/comments
Physo_354177predicted protein
Physo_523948kinesin-domain-containing protein
Physo_523063transmembrane protein, putative
Physo_306656AlNc14C26G2604
Physo_565803Major Facilitator Superfamily (MFS)

Sequence
8960 bases(100 bases per row)
TCATCCACTTGACGTTCATCACGCCCAAGGATCAGCCGGTGACTTGGCCTGCGCTGGCCGAAGATGGAGATCTCAGTGTCAGTGGCGACGAAAGCATCGA
CAGCTCAAGTAGTAGAAGCGCCAGCATCAACGGCAGCCACGTGAGCGGCATCAGCGAGGAGTTCAGCGAAGCCGGCTTCACGGAGGAGGCCCAAGGCGAC
CTGCGTGTCGAGATCTGCCGCCGAGAGGAGCCGACCAACAAGCAGTTCACGTTCGCGCAGCGGCGCTCGATCGCGGAGTTCGTCAACTGCATCGTGCACT
GGCAGTGGCGCAGCCTGATCTACGACTGAAGCGACGTGGCTACAGTTGGCAAGTTGAAGTTGTTATGTATGGGTAGGTAATGAAATGAACGTAGCATTGC
ATTCTACAGTACTGTATCGCCTGGAATTGATAACACAAGACCACAAACGATCGTCTTGGAAGACGGTCTTCCCCATACAAAGCCTCGAACACTTGGCAGC
ACAGAACGAAGTCAGCGAATCGCTGGCATGAAGTCGGATCGTCGGGGCTTGTCTCTAACTGCAGTGCGTCTACACGCAGCTCAAGACAGATGTCCTCGGC
GAACGTGGCGCGGCGTAGCCAGAGTTGTTGATCGTGGTCGTTGCTTGCTTATTGCTGCTGAGCGGCGACTGCATATTGTAGCCACCAATATCTCGTCGCC
TTTCAGCGACCGCCTATCGACCAAAGACGCGATGAGATGGTCCGAGCCACTCAAGCTGCGGGGACAGGCTTGGTCACTTCCATTGCGTTGGATGGCCTCA
GCTCGGCTTGAAACGCTGCGGCCATTGTTGGTCCACCACCGACCCTCGCTTCAAGACAGTCTCATTCGCGATGGATTTTCAGGGAAATGACATGCCACAA
GACAGGCTGAAATTACCGCCTGTCTGCCTCATTGACTTGATCTCACTATGCTCGTGCGGGACAAGCCCGGTGTGCACCACACATGTATGCCTTCCCACAG
TTCTGAAATGTGCATAACGCGACCAATTTTGATGGGCATTGCATCCCGCCCGTTACAAATTGCTTCAGTATCGGAGCCCTTGTCTCGTAGTGAATTGATC
ACTTCGCAACAAGACCCCTCCCTCCGCCCTCCCTGTTCTACCCGCCCTACCTCCTGCCCCAGTATGGACGACCACTTCGACGTGGAGTGGCGCCAAGACG
CGCTGGGCCTGCGCTTCACGCCCAACCAGAACGACCAGCCGGTGGTGTGCCAAGTGCCGCCCAACGCCTGCGCCGCCGTGCTGGCGTCTCCGCTGGCCGT
GGGCGACGTGCTCGTGGCCTTCGACCTGCAGCAGTCCGAGGGCATGCAGCCCGTCAAGGCCTTCGACCAGCTGGTGACGGTGCTGCGGCGCGCCAAGCTG
CCGGTCACGCTGCGCTTCCAGTCGCGGGAGAAGGAGATCCCGCCCAAGGTGGACGAGGCCGACGTGGCCCGCAGTTACGTGTTCAGCTGGCTGCCGCAGT
CGCCTCTCGGCGTGTCGTTGGCCATGGACCCGTGCTCGCTGCACGCCGCCGTCACGGCCATCGACCCCAACAAGATCTCGCCGGCCTTCCAGAACCTCAT
GCCGGTGCTCGGCGACGTGCTGGTTGCTATCGCCCCGGACAGCGACAACGGACCAGTGACGCGTCTCGACGAGATGCGCTTCGAGGACATCATCCAGACG
CTGCGCCAGTTCCCGCGGCCCTGCCGCCTCACCTTCGCGCGGCTTGCGGAGGAAGACTCGTCGGGCTCGGACGAAGAGAACCTGCTCTTCCCATCCAGGC
CCCTGGCGCCGATCACGCGACCCAAGGCCACCTCGTCTTCGACCGACGGAGGCGAGGAAGCGACGGACATTCTCCGCCCCCCGTTCCTCATGCGACCGCA
GACCCGCCCCATGTCGCGCTCCAGAGCGGGTGTACCCCCTCCTACTCGGAAACTGATCCCAATCTCGAAACGCCAGAGCTTCCGCATCGACAAGCCGATT
CCCGATGGTAGGTCTCACGCTGGTTCCAATGCGTCCAACGACGGCAGGGCTCACTCTGGATCTACCGCGTCCAATGGCGGCCGATCGCATGCGGGTTCCA
CCGCCTCGAACGACGGCCGACCGCACTCCGGATCGAATGCAGATGACCGCGGGTTCTACACCGTCGTGTACAGCGGTGGAGCGGTAGGCCTGACGCTGCG
CGACTGCACGCAGGACGACAAGGGCTTGACCAAGAGCAATGACAAGACCAACCGCACGAATGGCTACACTGTGGCAATCCGAACCGTGACGAACCCCAAC
TCCGCCCCCGGCCTGGAGAACGCGACGCCGGACGACCTGCTCATGGCCATCGGCCAGAAGGACCTGCAGCACATGTCGTTCGACCAAGTTCGCGCTGAGC
TCGGAGCGATCCAGGGACCGACCCAACTTCTGTTCAAGAAGCGCAAGCGCGTCACTGCCAGCTCCTCGGGCGCTTCGCTGGTCGACACGTTGCTGCTCTT
CCTCGTGTAAGGAAGAAGCAAAGGTGAACATCCAGCCAGCCCTACGAATCGTGTCGAATGGCAAGACACGATAGATTTTGCACGTCTTGTATGTACGTGA
CGATGTCAATGAAAATATGAAACCCTGGTTTGAATTGAATAAATGGGCTTTTGCTCGGAGTGTGTGGTGTTTTGGTTTCCCCAGCTATTCCTGCACCCTA
ACGGCTCGAATCTCTTGATACGCTGTGTATTGGATCCGAATTGCGATGGCCACAACGACGTTCCTCTGGCATGTGACGAGGCATGCATTGCGGATACCTG
TACAAACCTGAAAGGCAACTTGGCCTTATCAAGCTCGACTATAGACATGGCTACATTTCACAACTTGAAGTTGCCTTGCGTCACGACAACCGCGTACATG
TAACAGCATTGCACTAAGCTCACTCAGGCCAAGCTCCAAGTCTCTGCTAGCGTCCTCGCCTCCGCAGCTGATTCGCTCCCCCTGTGCTCTCGAATCTCTC
GTTTGGGCTAAGAATGCCTCGCCAATGCTGGTTGATGGCTTGTGTGACTGCACAAGGCCAACCTATTTCCAGCCCTATTAGTTACCCGCCTCCCATTGGA
CAAAATCCAAGGCGGAAAAACGAACTCAGATATACTTAGTAAAAGTAAGGGGGTCAAAGACTTTGACCCCCTCAAAGTGCTCATATCAAGCTACTCGACG
ACCCCCGCGCCCTTGCTGCATGCCCGAGAGCTCCTCTTCGTCCTCGTCCTCCTCCTCGACCGCGCCGCCCATGCCCAGCAACGAAGAGAGCGTCGCGCTG
CGCGCCTCGGGCCCGAGCAGCAGCTCGCTGGCGTCGCCGTCGCGCGCGCGGCTGCTGGCCTCCGCCGGCGTGGGCAGCGGCCCCGCCGCGCCCGACGAGG
CCCACGCCGTGCGCCTCAACGTGCTCAACAGCAGCGTACAGGAGGCGCGCGATGCGCGCAACTCGCGCCTCATCATGTGGGCCATCTCGCTCGTGAACGT
GCCGCAGATCGCGGCGGCCGTGGCCATCCTGGCGCTGCACTGGCAGAGCGAGACGCTGTGCTACCGCATCCAGGTCTGGGTGCTGCTGCACACGGTGCAC
CTGGCACTCACGCTGCTGCTCGAGTGGACGCTCTACTACCTCAATGGCGCGCGCAGCAACAGCGCCATCCGCCTGCGCGAGCACTACATGGCGCCGCTGA
GCCAGCTCAAGTACGGGCTGGACCTGGCCGGTCTCTTCTGGTTCCTCGTGGGCAACATGTGGGTCATCAGCGACGGCGCGCGCTGCGACGACGGCTCCGC
CATGTACCAGTTGGCGCTCTGGATGATCGTCATCTCGTACGCCAAGATCTTCCTGCCGTGTCTGCTGCTGCTGGCGCTGCTGCCCGTGCTCTGCTTCTGC
CTGCCCTGCGTCATCCGACTGCTCAGCCGGTTGCAGGACCCCATGAGGGGCAAGGGAGCCACCAAGGAGGTGAGCTGCCTCGTAGTCATTATTATTATTG
TTACGGTTGGAGTAACTTACAATGTATTTTATTGTTGTTGCAGATTATCGACCGGTTAGAGACCAAGACGTACAGTGCCAACATGTTCCCGCCCGAGGAC
GCGTGCTGCTGTATCTGTCTGAACGACTACGAGCCGTCGCAGAGTCTGAGAGTGTTGCCGTGCGAGCACCATTTCCACAAAGACTGCGTGGACGAGTGGC
TGCTGGTGAATTCCACGTGCCCGACATGCCGCAAGTCCATCTTCGACCCAGCAGGGCAACCCGAGACTGCCACTGCGACTAGCGAGGAAGACATGCTACG
GCGCGTGTGATGGCGAAAGCCGTTTCTACCCGCCAACTCCCCAAGGACAAGTGATGCAACAATATTTTCTTTTTATGGTGTTGATATTCCGGTAGCCCTC
CTCCCAAGATTGATTTTAGGGAGGCTGAACGTGATGTCTCCGATTTTTTTGCGTGCTGAATTACAAGCTATGAACTAAACAACTATACGGTTGGTGACGC
TGAAAATACAACTTCTGGGTCGGCAGCCTCCACCGTTGCCTTGCACCGCTGCAGTAACTCTGTACGCAGCACGCCAATTCGGTGTCAATGAGCACCCCAG
TACCAAAATCCGAGTTGAAAACCAACCTTGCAGATTGCGTGTGCTTTCACTGATGAAGTTTTTCACTCCGATATCATCATCGTCCGTGGTGCCAAACTCG
TGCTCGCTGGCAAGATCGGCAGCCAAAGGCTCGTCATCTGAGGTACCTGAGGACTTCCCAAAGTCATCAGCCGAAATTTCTTCAAGGAGTCGGGTGAGTG
TGAGTGCTTCGCCGTTCAGAATGAACAGGTCTGGAAAAGCCTTCGCTATCTTTGATTCGGCACTGCTGTCGATGGGATTCCCGCTGAAGTCGAGGACTCG
AAGACTTGGCAACTTCAATGGAAAAAAAGTTAGTGAGAGGTTTTCGAGGAAACGAGTATCAACAATTTGCACCTTTGTCGACAAAGCAGTAAAATTGATG
CTTCGGATCTGGTTGTTCTGCTCATTTCCGATAGAAAAAAGGTGGGTATTAAAATATGGTACATCGACTTCAGGTGCGATCGTTGAGTCTTACCGCAACT
GAAAGCTCTTCTAGCAGAGGCAAACGTGGCATGCTGTCTGTTACATAGGTATAAACAAACATGCAACTATTAGCAAAAGTTATCCAATATTTTACAAGAA
ACTCCATTTTTCATTGCCTACGAACCGAGTGAAGTCAGTTGGTTGTTGGAAATGTGAAGACAGCGCAGCAGTGGCAACGAAGGTAGACCTTCCAACGAGC
GCAGCTGCAGTTCACCATGTGAGACCCTGCCGAGACAATTACCATTTTCACGAAAGACTAAGCATACCTCATTATGGGCCAAGCTGAGCTCCAGCAGGTT
CAAACAGGACTCCAGCTGAGCCAGGTACCGGATTCGCATCTTCGAGACGTCCAGCAGCGCCACCAAACTCACATCGTAGTGGCCGCTACGCTGCTTGATG
ACGTCCGCGGTCAGCTCCATGGCTCTGCAGGTGTCGACTTTTCACTCGTTTCGGTTCCCCGACTATCCATGACAAAAATACTCGAGCAAGAGAGCCCAAT
GAGTCAGGACCAAGAGCACAAAGCCACGGGCGAGCGGGGTGCAGGCCACCTCGAGCTCTCTGCGTCGTAGCTCCGGATCCAGTCAACGCCTTGCAGTAAC
TTCAACTAGAGCTCCGGATGCTTGGAAACCTCCTGCTCTCGGTTAATGGATGAAGCTGTGGCGAGCCGTCGGCTGCGGACGACTCAGCTCGAGGGAACGT
GTTCCGTAAGCACGATCGCGAGCTCTGTTGTAATACACGAGCTGGCACTCCACCACGCAGGCTCAAGGATGGAGAGACCCCGCCTTACCTACCATACCCA
CTTGAGGCCAGCTTCACAGTAAAATCGTGGACCTTTGTCGACAGCCGCCGACTCGACTGCTTCTGCTTCTGCTTGGGGCAGCACGTTGGCTTCACGCTCG
GTTTAACAGCGATCTGCGTACGGTACGGCTAGTTCAAGACTGGCATCGGCCGACACGCAAGGTTCGCTTCGCTTGGTCGACTTGAGCGTAGATCGCCAGA
ACGAGTCAACTTCAAGCAGGGATGAGCAACGGCTACGCTGGCCTCGCTCTCCATGGCTCGGAGCTGCTGCCCGCCGTCTTGCCAAGACACCAAGACTCTT
GGTGCTGGCAGCAAATTGCTGAGGATTGGCACTGGCCGTTTGACATTTTTGCTGGAGGCCTTGCACTCGCCTTCGTTCGTTGAGCTGCTTTGGCGTTTTG
GCCGCGATACGAGGCGTATTACGACCGGCGACAGGCAGCTACGAGCGACAGCAGCAGAAATTCTAACGGCGAGCAGCAAAGACAACGCACCAGCAGACTC
GTTCCAGGCAACTTCAACCACCACCCTCGGGACCGAACTTCGACTGAGATGACAGTACATCAGCCGGCGCCTTATTTGCTGTAATTGCTAGGGAGAAGAT
ACTGCACCATCGGCGCTACTTCAGAGCTGAGCTTCAGCGTCGGGGACTCCCGGCTCAAAGGGTCTCCCTCCATGCAAAGTGCAAGGATCTCCCGATAGTC
GACACTAGTCAGCTGTGCATTTCACCATGCCATGCAGTGCCGCGGCAAATTAAACACACGAGATCTCTATGGTTTATCACCATGCCGTCCCGCACTCCGA
TATCCATCGCTGTTGCCATCAACTTGACGCTGGGAGGGAGGACGGCTCTGATTTCCATCCAAACCGAGCTTTTCGCTAAACGCGCGTGCCATCGCCTGAC
ACGCAAGGGGCTGACCTGGAACCGTTTAACGACGAGTCTCTCGTGCATCAAAGCTCCCGTCGCTCGCCGCCACGCAGAAACGGGGCCGCTATATATCGCT
TCAACCTGCGTCCCTGCACACAGGAGACCACCACGGGCAGCTCTGCAGCTCTTACTCGATCGATCCACGCCCTCCAGAGCTCTCATTCCTCAATTGGCGG
CGTCGCGCGCACCCCGGTCTCCTCTTCCTTCCTCCACTTTTCTCCACACTCTTCGACTGCCAGCGATGACCGATCCGTCCGTGCAGCGCGTGACGCCTCC
CGCTAAGAACTGCGGCGGCAAGGTCCGCGGCGTGCTCGTCAAGCACTGGACGGTGCCCGAAAAGCACCGCTCCGAGCAGCAGGACGCGGCCGAGGAGTAC
CTGCTGACGGCCTACCTCTTCGGCAAGTACTGGACGCTGCCGTGGATCAAATTCAACCGCTGGTACCTCTTCTGCGCGAGCTTCATGGTGCAGTTCTGCA
TCGGCTCGCTCTACTCGTGGTCGGTGCTCAACAACCCCATTGACCTGCTCATCTACAACGACAAGACCAAGGGCATGGCCGTCAACGCCTTCTACATCGC
CGTCGGGGTCTTCGGCACGTCCACGGCCATCATGGGCCCGTGGATCGAGCGCAACGGCCCGCGCGCCGGTGTCGTCCTCGGCGCCACCTCGTTCCTCATC
GGGTGCGTCGTCAGCTGCATCTCGCTGCACGCCAAGTCCATCGTGGGGCTGTACGTGGGCTACGGACTCTTCTGCGGCTTCGGCAGCGGTCTCTGCTACA
TCTCTCCAGTCTCCGCGCTCCAGAAGTGGTTCCCGGACTACCGCGGCGCTGCTGCAGGCTTCGCTGTGGGCGGCTACGGTGCCGGCTCCGTGGTGTGGGG
CAAGGCGTACCTGCCTATCATCGAGGCCACCAGCGTGCCCGACCTGTTCATCGTCGTGGGGTGCGTCTTCACCTTCATCCTGCTCTGCTGCGCCGTGTGT
CTGCGCACGCCGCACGCCACGTTCCACGTGGCCGGGCTCAACATGCACGGAGAGGCGGTGCGCGAGGCGGAGGAGTCGTTCGCGCGCGGCGAGAAGATCA
GCGTCATGTCCGCGCACGAGTACGAGTCCATCATGACGCCCACGGCCAAGGAGATGGAGGCGCTCGTGGACCCGAGCGCCGACCCGCACGACACCAACTC
GCAGGTCAAGAAGATGACGCTGATCCAGGCCATCACGTCGCCCGACTTCATCTTCCTCTACATCATGTTCTTCGGCAACCAGCTCTACGGCCTCATCGTG
CTGTCCAAGCTCTCCACCATGTGCACGACGCTCTTCGGCAAGACGGCCGACCAGGGCGCGGACATCGTGTCCATCAACGGCGCCTTCAACTGCGTGGGGC
GCCTCCTGTTCCCGCTCATCTCGGATGTGATCGTGCGCAAATTCAACGTCGAGCACGCCTTCGCGCGCAAGTGCCTCTTCTACTACGGGCTGGTCTCGCA
GATCACGATCATCGCCATCTTCCCCACGCTCATCCGCAACGAGAGCTACACGGCCTTCGTGGTGCTCGTCTTCCTGCTCACGCTCTCGTACGGCGGCGGC
TTCGGCACGATCCCGTGCTTCCTCACCGACATGTTCGGCGCCTTCAACATCGGCGCCATGCACGGCTTCATCCTCACGGCCTGGTCGCTGGGCGGCGTGG
CCGGCGGCCTGAGCTTCAACGCCAAGTACAACGCGGCCATCAAGGACGGCACGACGCCCGTGGACGCGTACGTGGACGGCATCTACAAGATCCTGATCGT
CGTGTGCGTCACGGGCATCTTCATCTTCATGGTGCGCACCAACCCGCGCGACCGCTTCGAGAAGGGCTACCACTACAGCCTCTTCGGCAAGCGCGTCATC
AGCATCAAGCCCAAGGACACGGCCGCGAGCAAGGAGGACCTGCTGCAGAGCGAGGCCTAAAGAGGGAGAAGAAGGAGGAGAAGACTATTCGTACTATGCT
AGTATACAGTATGTAGCTGACTAAAGCTTCGCAGTGAATTGAACGATTTGTATGAACGAAAGCGCCCTCTGAAGGTGTTTTTGTTGAAGTTGTTGGCGGT
CTAGCAAGATGCAGTCTCTCTTGTCCCGGTGTTGGCCCTTCGCTCGCTCGACGTTGACAT