Description :
From Genome Similarity Track
Location :
Scaffold_44:297258- 298305
Sequence
1047 bases(100 bases per row)
ACTATGCCAAAATTACAAATATATCCAAAAGCGTTACACAATTAACTCGCGCCCTGATTAGGCAATACCTGCCGACCTGCGACACTGACTGGATCTGTCG
CACGATCAGACCGTCTCTCGCCCTCGCGATTGGACGTGATGTAAACATTTCTGCCCAGCACGAAACGCATCGATTGGTTGCAAACAGCCAGGCGAGCTGC
GCAGAAACTTGATTTTTGCGCAAAACCTGTCGTATGTACTGCAAATCGGGCACAGTAACCACTTTATTTTCTAAGAGCTCTGCACACTTCTCAAATAGAG
ATATTTATTATTATTAATGTAGACTTCACAGACCAGTATTTTGTAAGAGATCTGGAATGTTATTTTCCAAGCACTTTTTCAGAGTAAAGACGATATCAAT
AGTATTAATATTATTAATATAAGCTTCACAGGCCGCATTTGTAAGAGCTCGGCGATGCTTTTTTCCACAGACTTTCTAAAGTAGAGACGATAGTATTTTT
TAATATTAAAGTAGGCTTCACGACCACCGCGTTTTGTAGGGGCTTTGTAAATATTATTTTTACTTCTCCTGGCACTCTCCACTGTCAGCGTGCAAGAAGG
CGCGCGGCCGCACGGTCATTGCGCTATCTGCTCCCGTGCACCCCACCCGACGAATGCATGCGCGGACGATAGATAATTGTTTCTGTCAATTTATATTGCA
TGTAATGTATGTATTTGCTTGGAAAATTTGATATTATTTTCAATATAGCAAAAAGATAGTAGTATTATAAAACATTTTAATATTTTTGCTTAATTATAAA
TGTCAGCCTTTTATTACCGTGCTATTGGCTAATATTTTACGCACGTTTTGTTAACTTACTCACAGTTTGCAAAATGGTGGGCCCTACGTGCAAACAATGC
GAGGCGAAGATTGACCCGCTTCTGCTGAACCCGCAGCGGTCTACGACGAATTCCCGGGCGCGCTGCGTCTGCTGCGGAAAGCTGCAGTACGGCTACGCAT
TCCGTACAATCAGCGGGCGGGACATCGTGCGGCGCTGTATTGCCTGC