Description :
From Genome Similarity Track
Location :
Scaffold_4:297250- 299236
Transcript NameFunction/comments
Phyci_76401Hypothetical protein
Phyci_76402conserved hypothetical protein

Sequence
1986 bases(100 bases per row)
ACAGCAAGTTGTTGGCGTCTTGCGGGGCCAGCAGCGGCGCGAGGTGTGAGTGAAAAAGCGTGACCAAATTGGGCAAATCAATTAGGGCTTCTCGACCTGC
TTTCTTCGCCTTGGTAGTAGAGCGCCTTCTCCTTCCCCCTCGACGTTGGTCAACGTTCTTCTCAGCTGAAGTGGCTAGGCGCTTTCTTCCGCGCGTCATG
GGTCCCAGTGAAGAAGAATGGAATTCTTCGCGACCACAAATTTGCCCAGCGAACGACGCTGTACTGGACGCTGTGTTGTCTAATCCTAGATATGAAACGT
ACCATTGCCCGACAAATTGCAGCATATCATGACCACTGGACCGCACGAAAAAGCGATTGGTTAGTTACAACATACATGGTATTGAGCTCAAAGAAAAAAA
AAGTTAAAGAAGCAAGCCCGTTGCGCGGCATCTAGATATCCTCAAGTCCGGTCGCTGATCTTGATCCGCCAGGTTGAAGTATTCAACAGGAACATGTGCG
TTCGCCACCCGCTGTTCTGCAGCATTTGGTGGAAGAGCGGGAAGTCGGCCGTCATCTTATGAAGTGTAGACTCGAGCAGTGGCTGATGCGTGATGGTGCC
ACCGTTCGAAGACGGAGGCGGTGATGCAGTAGGAGGCACCGAAGCCAGAGCCTGGAGCACCAGCACAGCCTGGAAGAACGCGCGCAGTTCGTCTTTGGGT
TTCGCCTCTGCCTGGAACATGACGTGCACGCAGTCTCCCACCACAGTCAACAAGTAGGCTTCGTCGCTGCATCAATAGAGCAACACCCAAAAAGGCATTA
GGAGTGCTTCAAGCGAAAAGGGATAGCACCGGGAAAGCAACCTACCTGTATAGTTGCATCAGTCGGTCGAGGTCGCGCGAGGTCGGAACGGCCTGGTGTA
GCTCTGCCCCCATGACTAAATGGCTCGTCACTGGCAGTACTGGATCTCTAAAAATTGACTCCTCTTGGTTGACACTGCGAACAGAGTACTGCATCGAGCC
CACGGaataacaacaacaacaacaacaacaTTGTTAGAAAAGGTCGCGTAATCACGTCAACTTCGAGATGATTCCCTCCGATCACCTCACTCACACTCAC
CCGTCCATCGAGGTCGGCCACAAGCTCCTTGCCCGGCTTATTGCCCGACGAGAGGAACCTCTGCACCAGAATCAGCCCGCGCGAGCAGTTAACCGTGGGG
ATACAGAGGCACGACACGGCGTGGTAGTTGGCGAACACGTGGATGATCGTGAGCAGCAGGAAGGCGACCCAAACGGCGCGCGGCGACGAGTTGACGGCGT
TGGCGAAGTACATGCCGAACATGAGTCCGAAGAGCTTGACGGCCGTCTCCTGCGAGCCCTCCTTGGCGGCGCAGTCGGCCATGTTGTCCCTCTTGGCGAA
GTGCGTCATGAGCGACGAGCGCGTGGCGCCCGCGGCCACGCCGCACATGGCTTTGCACACGCTGGAGACGCACAGCACCTCGGTGACGAGCGTAGGGAAG
TAGGGCGCCACCATGTCCAGCGTGAGTCCCATGTCGTTGATGACGTCGGCGAACAGGCGCCAGCGTTTGACGTTCACGTCGAACTTGGGCCCCACCAGGT
AGGCGAAGGTGAGCCCGCCGATCATGCCCGAGCCATCGCGCAGCACCCACTGCAGCGCGGCGGCCAGCGGCGTGGCCTTGTCGTCGCCCACGCCCACGCT
CTGCAGCACGCTCTGCGTGGCCAGCACGCCGCGCAGGTAGCTGCACATGGCCTGCAGCGTGTCCCAGCCCTGGAAGCTCAGGTAGTCCTCGCTCACGCTG
TCGGGGTAGCCCGCGGGCAGGAACATCTCCTGCAGCTCGCGCGTGAGCCCGGCCAGCGTCAGGCAgccggcggcggacggcgcgcgccccgagccggcgg
ACAGCAGCTGCTCGCCGTGCTGCACGTAGCGCCGCGGCGCCTCGTTCGCGCACACGGGCCGCGTGTCGAACTCGGTCACGCGCACG