Description :
From Genome Similarity Track
Location :
Scaffold_1542:2971- 4364
Sequence
1393 bases(100 bases per row)
GGTCTCCACTTCGACCGTTAACATGCCTCGTGGCACTGCTAAGAGCGGTGCTAAGACACGCTCCAAGGCTGCAGCCGGTAAGGCGCAGGCCAAGAGCACT
AAGCCTCACGGCAAAGGCTCTGCACTCAAGGAGGCTACTCAGGTGGCCTCCGAGGCGATCGGATCCTCGGGTGACGCGGCTGCGGACAAGCGCGCAAGCA
GGCGCCGCAGTCCGTCGCCCTCGTCTTCAGACAATCGTCCGAACCCTCGGTTCGTAGAACATGAGTTCAACTCGGGCAGTGAGGACGATGCCGAGTTCGA
GAGCACTCATGATGCTCCTGCGGGCTCTGTGGGAGGGCACAGCCCAGTGCCCAGTGAGCACAAAGAAGACAGCGTGCAGTCGTCCGCTAGTGATCACGGT
GATCACAGTCCCAGGACCTCTGTGCGCTCTGAGAGTCCGGCCGTTAAGGCTAAAGGGCACTCCCAAAGCCGGTGGCGATGAGGAAGGGAGTCCTCGCAAA
CGTCTCTCGCTTGCCGAGGGTCTTGCGCGCGCTAAGGCCTCTAAAGCCGAAGGCGCCAAGCCCTCAAAGAAGCGTACCGCCTCTAAGTCTCCACTCCGCG
AGGAGAAGGAGACTCGACGCTCCTATCAGAGTCTCTTCGGCTCCTCGGATGAAGAGGAGGAGAAGGAGGAAGAAGAGGAAGAGGAGGGTGCCATTGTTGA
GCCCCGGGAGGTCTCGAATGACCTCGACCAGCAGCAGGAGGATTTCCAAGCTGCCCAGCGTGTGCGTGGGGGTTCGGTGGCGGCACCCGTCAGCCAGGGA
GCTGCCATCAACTCAAGAGGGTATTGGCCTCCCGAGGAGAGCTCTGGGGCTGACCTCTTCTTAGAGCTTCTCGTCGCTCCTCGTGGCCTTGTGGGCGGCC
ACACTTCTAGGGGCATCTATGAACGAGCCCTTGTTCAGAAAGAACAGTTGTTCGTCGACAACGTGGAGGCTGCTCGGTGTGTGCTTCTCGCGCCACACCG
CATTCCCCTTAAGGACTTCACGACTTGTCGTAAGAAGCCCGAGACCCGGGGTGGTCTCTATCCTGTTTGGGGATACCCCTGGGTTATGCCCGAGAACTGT
CCCACATGGAGTTCTTGTGAGGATATGTTCTGGGCGTGGGTGGAGACTCTCAAGTACTCGCCCACGGAGTTATGGGAACTCCATGAAGATCAGCAGCTGT
CCCACATCCTGGACCAGCGTGATCTTCGTGTGAGGTTTGCTTACTTGATCAGCAAGCGTATGCTGCCAAGGGACATCCTAAAGCGCGCGGCTTCTAGCGC
TCACGCTGAGCGCGGGTACGGTATGTATTCATCATCCGTACCCCGTTCGGGCAAGAAGCCCCGGACTACTTATGAAGCTGCCGCCGCTTCTGT