Description :
From Genome Similarity Track
Location :
contig_97:29706- 34963
Transcript NameFunction/comments
g10902.t1hypothetical protein
g10903.t1hypothetical protein

Sequence
5257 bases(100 bases per row)
CGGGACGACGCTACCGACAAGGGGCGTCAGTTTCGCAAACAGGTTCAGTGTTGATTCCCTGATGACTGGCAACTCCACGTCGAACAACTCGTTCGCGTCG
AAAGAGCCAAGCACGATCCCTGCTTCTTTCAGCATACGCATCAGAAGTTTCACCGCCTCAAGTTGGCTGGTTACTTCCTTCGGTGCCTTCACTGGGCCTT
GAAGTTCCCCAATTGGCTTCGGACGCACGATCTTCATTACAGGATCTTCGTGCAGGAACTTGTACAGGTCCTTGTAGAAGAAGGCAGACTCCAGTTGCTC
GTCCGTCCACGTGTTGCGATCCTCCTGGTCTTCGGCTTCAGACTCCGGTGCCTTCAGCTTCTTGCGTGAGGTCTTCGACTTCTTCTTCGAGGTTGCGAGC
GAGGCTGGAGGAGTGGTTTTGGATGAAGGTCCTTCGGTTTTCACCGTCGAACCTTCGTCCGGCGGATCACGATTCGCATCGTGATCCGCGGGGGTCCCCG
AAGGGACCTGGGGAGGGGGGTGAGGCTTTTCTTCTAGGTCCATCGCTGAACCTTCCTCCATCACATCGTCAGAGCTCCTCCCAGCACTCTCACGATCAGA
TGATCCTGGCGCTTTCAGCGCCGTCGGCGGCGATCCATCTTCCGTCGACGACTCGTTCCCTGGTTCCGTCTTGATCTTGACATCTTCTTCGGTGGACTCA
CGGTGAAATCCCTGTGAATCACCAGAAGATCCGGGCACGCGCACCATTGTGGCGGAGCGGGATCGCGAAAATCGATGACGCGATCCGAACTTGCCAGCGG
TAGGCCCAGACTGCCGACTATCGGAGGGGGTACTCCGTTGATCAGGCGTGATCAGAAAACCTTGTAGTCACCTTGTGTACCCGACGGCGGGGCGGGTTAC
GCTCTTCCGGTGTTCTGAAGATGTCAGTGGGTGACCAAGGCGGAGGTTGGAGCTGGACTGCTCCTTCCGGGGAATGGGTGGGTGACGGCCACGCGGGTAT
CCTTCACGCGGTCGTCGGTGTTGGTGATCGGGTCTTGGGACAAGTCGATCACGTGGGGGGTGTCCTTGGGGTGTGCTGTTATAGCCCTTTCCGTTGCTTG
CCGCCTCCTCTGGCGGGGTCTTGAGTTGAGATGAGAGTAGACGATCGCACCCTGGCCAAGCTATCCAGGTCTGCGTCGTGTCCTTGGTCGACTGGGTGGG
TCCTTCGTCGGGTAGGCCAATGTAATTCCTTCCCCGGAAAGTATGGACGCCACTTGTGTCTTGCAAGGCAAATCTGAATCTCTTAACCAAAAGTAAAGGT
CCTAAAGATCTCTCCCTATCCTGCTTTCTCCCTATCCCGCTTGCGCATCCCTTGATTGCACACCGTAGCTTGAACTTGGTCTGATGTACCAAGATCGCGG
TACCGTGTCGAAAAGATTGGTCCATTGTACCCACAATAATCGTGAGTACAGATCGCGTATCGAAATGTTTGTCGCATGTCGATCTGGATCAGATTGCGTA
TCGAAATGATTGCTCAATATCGATCTTGATCAGGTCGGCATAAATGATTACGCCATACTCATCAGGTCGACATGTATCCACTTCAATCCGGAGGTGGATG
TCTTCTGAACACAACCGGACATAACTGGACACCACTGTACACAACTGGCCATAACTGGACACATCCGCAATCTTTCCATCGCGATTCCTCCAAACGCGAT
CTCATGCCATCAGTCCCTTCCGAATCGCTCAATCTCTCCAACTGACAAGTCGCTTCACCTCAAGTGCAACTAGATCCTTTCGAAGCTCGACGCCAATGCA
CGTTCTAACGCTCGTCGCAAGTGCAACTTGAGCGACAATGTTGCCCACACCAGCTCCAACATCGAGGAAAACGTCGGCTTCTCCGAGGGGTCCAACAGCT
TCAAGTATCTTTGAGACACCCGACGGTAACACCTCACCAGCATTGCCATAAGTACGGCCGGCTTGCTGGCGGACATCGTGCGCACTGATTCCTGCAAATA
TGAGATTCACAGCTTTCGCTGCTTGCCCTGGGTTGAGTATAGTTTCACGTGACTCAGCGGCGACGCAGCCCGCGAAGGTGGTACTGCCCACAGACTTGAA
TATGGTGTGGCTCACCGGCTCGGACGTGGTGTTGACCGCAGACGTGGCTACGGCGGCGATCCCGACACGGTCACCAGCCTCGGCGGAGAGGCTGGGCATG
GTAACGGAGCCGCGCACGGACTTGGTGGCAGCGCGGTCTGAAGCCTTGGCCTTGACGTCCATGGCGGCACGGACACCAGACTCCGCTGCGAGGCAGCTGG
TGACGGCGGTGTCACGGACAGACTTAGTGCGCATGACCTCGGTGTCGGTGCTGCTCGCGGGCTGGTTGGGGCTGTTGCTCGCGGACTTGAAGGAGGACCC
GGTGTCGGTGCCAATGGCAACACCACCGCCTGATCCGTTGGAAAGACTAGCCGAGGTTGTGGTGGAGGGCGTGAGGCCGAGACGGGGAGGTGGTGCGTGC
GTCGGCGCTATTAGTCGCCGGGAAATGGGGAGAGATGGCGGCGGCCGAGCTCGCGCGACTAGAACTCCCCTGGAAGGCAGACCACTGAAAAAGCACCGCG
GAAAGCTGCTTATGGTCTTCCCGTACGTCCTCTTGAGACTGGCCAGCCGAAGACGGAGCTCGTTCGCAGAGCGCTTGGTTTTCATCCGACGGGCCACATA
TGCCCAGGTGATGCGAAGGCCTTCCCTCTCGAACTGAAGTGTGATCTGGACCAGTAGCTTGTCTTCTTTGTCAGTGAAACTTGTGCGCATTTCTGCTAAT
TTTTGTATGTGAAATGAAGTCAGCATGTAGTGCATTTGACTTACCTTATGTATGGCGATATGACTGGCTGCACGGTGATACTGGTGCTCATTGTTTTTGC
AGCGCTTGGTCGATGACGCGGCGGTGCGGCTGCGACCGATTACGGCGGCTGAAGCAATAAAATACACCTCGGAGACGCGAGCATTTGAAAAATACCCCCA
TCCCTCTTAAACAAAATGCTGTGATTGGTAGTAATATTACACGGTAGGTCGAGCGCGGGATTAGGCTAAAAGGGCGCAACAATCGCCCTTTTAGAAGTCC
ATTTGTCACCGTGTTTTGGAAACAGCGTTAAAGGGCGAGAAATGCGCCCTTGCACCGCGAAAGGGTTAATTAATTAGCTAAGTTCGCTTTCGTTAATTTG
CTTAAGTTCCGACTTGCTTGAATATTTTTTTCTTACGAGCACGAATTTCCGTTCGATGCTTCTCATCATATTCTCGCTGCTTCGCCAGTCGCGTTTCCCT
TGTCTTTAGATAGTAGCGCCTTGATGCGCTCTTTATTAACCCCCCAACGCGAGGGCCTGTATCAGACACGATTCTTCAAAATGCTTATCCTGTATCAGAC
ACGTTAAGGATTCTATACTTGGAGTTTGTAAGGGAGCATACAAAGTTGATGTCAAGGCGGTTAGGTATGTATCCATTCCTCTCAGCTCATCTACCATAGC
CGTGCGATGACTCAGCCTCAGTATTTTGAGAAATTAGCTTCCAGAGGTAAATGGAGTAGCCACACACTAACCTATACAAAACCGCAGGTCATTTCTCACG
CCACTCATTTCCCGCTCACTCTAGAATCCTCCCCCCTCGCCGCACGGATGTCGGGATTTCAAGCGCGCTGGCGTGAACTTCGCAAAGATGGCTGGACGTG
GAAGCGGTCTGAGGGCCTGTCAAACGACGTGATCTACATCAAGCCAGGGAAGACCAAGAAGGACGTTCGGGCGTAGACGTCTTTGTGGGCGAGAAGGAAA
TCATGGAGTACTTGGACAACGTCGACTTAGGTATGTTTGTATGTAGGGGGTTCGAGCGGCTGATGTGGCACTAACAGAAGTAATGATGACAGCGGAGCTC
GCGAGGAAGCAAGCCGAAGGTGGAGCCGCTTCGACCACGACGTTAGGCGGCCAGGACGACCTGAATACTGGCGGTAAGGTGACTATCGTGTGTCAGACAC
GACATGGTTCAAATGCTAACGTGTCTGATGCAGGTACTGATAATCTCCCAAGTCACAACAGCGTATCGGAGGCTGGTGCCAGTGACCTTGTGCCTTCAGC
AAGCGTATCGACTAATGCTCCACATGATGGAGGTGAGCCGAGCTAGTATCGTGTCTTCTCATGTTTGTTACCTGACTCTATCGTGTATGATACAGTCAAC
CAAGGCATCGATAGACCCAGATCTCGCAGCAGCCCTCTCATCGCGACCTCCACGCACATCGACGACAGAGACAACAGCTCCGCTGAAGCGGATGAAGAAG
ATGACGAGAGCATGCCAGGTACGCTGTTCGAGTACTGCTTGACTGAACGTTGTACTCACGAACGTATTGATGTTGACACTACAGCTCCCGTCCTCTTCGG
CGGCGATTGCGCAGCGAGTTCGAACATTTGCTTTCCTCGGACAGCGAACCTGACATCCCCGAATGCTCAGATGCTGAGGGTAATAGTTCGAGACGATGTG
AAGATGAAGAAACGAAAGACGACTCAACCAGCTAAGTCCGCTCGATGGTATGCTTACGTTGTATTTCCATGTAATCGATACATGTTATTGATGCTATCGT
GTACTTGGTTTTGCAGATGACCCCAACATCATCTCACCTGGAGATCGATTGGACAACTATACTGCGCTGGACTCGGATGGAGATAACGAAGGCGACTCCG
TCTACGACGATGATGATGACCTCGGTCCGAGGAGCCCGATCCAGTTGATGAAGATGCTCTTTACTCTCCAGACCTTCACTTTGAGCCGTCACTTCTTCAA
AGAGTTGGCGGAGTTGCTGCCATCTCTCGTGGATCTGTGGACGCACATGTTCTAACGGACATCAAGTTCAATGGATGGATCGGGCCAGAGAAGGAGACGC
CGCTGCCGTACATGGACGAACCTTACGAGGAGCGACCAGCCAACTGGATGAGCGTAGACTATCCTAACATCTTCACTGGAGAAGGCGGACCAACACTAGA
AGCGATGAAAGCAGCATCGACTGCGTTGGGGGCGTTCTTTTTGTTTGCTCCTCCACAACTGTGGGAGACTATTGCTGGGGCCAGCGATGACTACTTCGAA
GCCAATCTCGACAAGCGTGTCGCTGCTCAACACGCAAAACAAGAGGCGCGACAACGCAAACAACCTAGCTTCCAAGTCCAGTCGCCTGCAGAGATCAAAG
AGCATTTGGAGAATACACCGGAGATTTCAGGCCGCGAGTTTTGTGTTTTTATCGGGC