Description :
From Genome Similarity Track
Location :
Scaffold_103:29702- 30970
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_13559Hypothetical protein

Sequence
1268 bases(100 bases per row)
AAGTGCATTCGAATACTGGAATCGATCGTAAAACTATTGATTATCTGCCACCTCGCCAAAAACTATTGGAGCCCAGCGCCACACTTCACACATTGGGTTA
CCGTTAGAGCCAAGGACTCCATTTCGCTTCGTGCGAAGGTCGTTTGATAGATAGACTGCAGCAAACGGTCAGTGTGTTTTCGGTACACGGGCGGACTCAG
GGGGCGAAGAAGGCATAAGTCTTGCCTGAATTACCGCCCCAGGCTCGGGGGACGGGTGGCGGGTTGCTTAGCGGGAGCTGAGATCTAAAATGAGAGCGTT
TTACACTCTCGAGAAAATCGTTTCGGCTCCTTGCGTCGTCATTATGATCTGTGTGAGGCCTTGATGCGTCGTCATTTCTAGAAGCAACACTTGTCAACAC
TTGGCGGTCTCCACTCGGACGACTTTGGCTCGCATCGGACCAACCGCAAGCTGTCCACGGAACGATCTGTTGGTTCTCTGTCGTCAACCCGCACAAGAGT
CTCTTGAGCGCGATATTCTAACGGCACACCAATAGACGCGGGTATTGTGTGGTCATGCGGCGCGACAAGGATGCTCAGAAGTTGCCCACTTCATTGTAGA
GCCCTGCTCAGAGCGTGGTGGTGTTAGCTTTGAGTGCTGCTTGTGGTGGGTGAAATGCATTGGTCTTTGTGAAAACCGTAGGCAATGTATCTACAAGTTT
CGACCGACAGACTCCGTCGAGCTCCACAGTCTACAGGACCGAGCATGTGATCCAGGTGGCATTATGAGTGACTAGGCTGTGAGAACCTGTGTGTTTGAAA
ACAAGAAAACCCGTCGCCTGTCTGCAAGGGTACGCAGCTGTGGCACTCTTCTCGTTTACTTGTGTCGTTACTACCGACCTTATTTGATTGGATGTACAAT
GCTTTAGGTTGCCGCAGGAACGATCGATGATGTTTGCATGGGTGTCGCTGCTGGTACCGACTTGACGCGTTGGCGTCACACTGGGTGGTGGGTCAGCACG
AGCGGCTGCAGCGTGATGATGCCACGTTCTCGATGCTCTAGACACTGGAATGGGAGCCATTACTGTTCTTGGAGCCCATGCCTGTCGCCCTTGACATGCC
AATCAATTGCGTGGAGTCGAATCAGGTGGCATCGATGGCTGCCTCGTCATGACCTGATACTCAGTTGTTTTCTTTTGGCATTGATGTATCGCACATCTTT
CCGGCTGCAAGTCGCTGCTGGTAGTGAGGCGTAGCGATCGTTCGCGACGCAACCTTTCTTTATGGTAC