Description :
From Genome Similarity Track
Location :
scaffold_85:29701- 31773
Transcript NameFunction/comments
g3113.t1hypothetical protein

Sequence
2072 bases(100 bases per row)
TGCTGGAGTGTCGTAAATACGAAGAAACACGTTTGTTGGAGAAGCCACAGCATCTCGCTTGTCAGGAATCGAGTCAGGTATACTTGCTGGTGTAACCGGA
CCAAGTGGTGGGGACGCGATGAGGCCTTGATAGCCACCTCCTTCTGTGTAGTGACTTTTCATGAACGAGCGGCGCATGATTCTCATGTGTGTCTTCACGT
CCTCCTGAGTCAAGTTGTGACGCTTCCCCTCCTGTTCTCCGTTGGCGACGTTGAGATCAACAAAAATGCCGGTGAGGCTCATGACAAGCACCAGGCTCGG
CATCGTGAGGGGCGTAATGATGAAGAGTGACAGCACTGGAAATATGACCATAAGAGTCAAAAGGGCTGATCCGCCACCGCTCGACGCCGACGTGTCTGAC
ATGCTGCTGATTTCCACAAGCGAAAGCCACACCAAGTAGAAAGCCTGTCCGATCGTGGCAAATTGAAAGAGTCGCAAGAGTAGCTTAGGACTGTTAAACC
AGAACCGGTCGTCGTGATGATGGAGCTGTCGGTGACACAGTGCTGACATCTGCATACGGATCATCGCACGAACAGCGAGAGCTGCCACCTTGAATTTCAT
TGGAGGCTTCTTGGGACTGCCATCTTCGTTCGAGTCTTCTGCAGTTGAGTCTTCGGCAGACTCCGGCGTAGAATCAGAAGCGGAGGGGGCGTTGTTCTGG
TTTTGCCAGCGTTTCAGCCCTCGATTGCGGTTTCCGGGCTTCTTTAACGCCTTGCCGAGTCGAGCCTTGATGTCTCTCGTTGTGATGATGCGAAGGCGGT
CATCAACGATACCACGGAGGATCTTCAGCACCTTGAAGAAGATAACGACGTTCACGAGTAGAAGTAACCCTCCAACGCCTATGAAGATCCAGTGGTCCTG
TCTCGGTAAGATAGACGGCAGCAGACAGATGACTAGGAGGATCAAGAAGGCGCTGGGGTGGATGTTGGTCATGTGATAGAGCAAGTTGCGCATGCAGAGG
ACGTGGTACTTGGCGTACGTCATGCAGTTTTCTTCTTCTTGACTGACCCCTTCCTCTCCAGCTTGTTGCGTGCCCCAAGAGCGAGCTCGAGGTGTTGGCC
GGACGCCAAATAGCCGCTCCATCTCAAAAGGGTTCTTGTAGATGTAGCCGCTCCGGTTCTGACAAATGTTGTATGCTAGGATCTCGAAACTCTTCCAGAG
GTTCCATTGCTTTCGGAGGTTGATGTGGAAGCACCAGCCTTCACGTTGGTATCGCTGAAGTAGCAGGCTGTACGCACGAGTTCCCATGACAAGATCCATT
CCCGATAGAGCTCTGGCTCTCATGGCCATTGATCGATACGCGACATCTCCATCCGAGCGCTGGCGAGGACGCATAGCGTAGTAATAGTCGTCCGTGGGCG
TATCAACTGTTCGTTCAGCATCGTCGATAACGCTGCCGCCTGAGCTGTGAGGGTTGAGATCACGGGCCAGTGAGGACACGTCTCGGATGAACGAATGCCT
CATTCGACGACTGCCACCATTGTCGTCTCGATCACTGATACTTCCTGTTACACTCGGGTATTGCGGATCGTACGTGTCGTCATGGATATCGCTGATGCTC
TCACGACGTTGATCAGGGTGGTTCTTGATCTCCCAGACGAGCTTGGGCACGACTGTACCGATGAAAAGCAGCAGCAGCACAATGATAATGAAGTAGATCA
TTGTCAGGAACACAATGTAGTGGAAGAACTCGTAGAAGTGGAGCTGCTCCGAGGCCGTCAAGTTGTTCAACGCCATCGACTTCAGCGCTCCGCTCGTATT
GAGCGTAAAGATAACCATAGACAGAAACCCCATGATCATCACCTCCTCGAAGATGCGGTTAACGATCTTGCGAAGCTGCGGACACTTGATGGTGGTGCGA
ATGTGGTGGATAAGTCTGTCCACGCCGATGGACACTGCGATGATCACTGCGAGCAGGAATGCGGCGGTGCGAATGTTCTCGTGCAGACACTGGGTGTTGC
CCACGCCCAAGAACGACGCTGAGTTGTGACAGGAGGGGTTGCCTTCTTCTTCTCCCCCAGCTAGTAGTCGCT