Description :
From Genome Similarity Track
Location :
Scaffold_1884:2970- 5941
Transcript NameFunction/comments
Phypl_g14319hypothetical protein

Sequence
2971 bases(100 bases per row)
TTTCGCTTTTTTCCCTCGCAACGGACAAGTTGCTCACTCGCCTAATCGCCCACCGCCACGGGTTGACTGCATGTGTGTATGTGTACATGTTTGTGCGAAA
TGTGGCTACCTCTGCTGTTTGTCGGAGATGTGCTAGCTACCGTTGAGACTAACATTGCTTTTCCGAAAGGAGGTTAAGCTTTGTGTTCGATGGTGCACTC
AAATTACATTTTTGTGTACTCTGTGAAGAGGTTAACTTTGCTGTTCCATTTGGAGGTTAGGCTTAGCGTTCAATTGGTCCAACAAAGTCATATCCGTTTC
CTCCAGACTCCTAAGCTTGTAATACACCCTGTGTTTGTCCCTGAGGCTTATCCTTCCGTGTTGTTGAGCGTGTTGTCCTTCACAGCCTCGTCTTCAAGGA
AGGTCTTACgaacaagaaggcggcgatgaGCTTCTGGTTCAAGTGGGCCTTCAGCTCCCAAGTCGGCTCCCAGTTGATGAGGTAGTATATCACCCGCCTT
TCGCGCTTCCagttcagcagcttgcgggCATACTGCACTGGCTTACCCTTGAGGTCTTTATCGGAGCTCCGCTTCTCGCCTCTTCAGGAACCAGCCATTG
GCGCACGTCTTCAAGACCGATTCTGCGCGTCTTCCGTTCGACGAGCGAGGCGATGATGACTTGGATcgcttcgacgagaaggcTTGCGGAGGCGATTGTC
GTGTTCATCGTATATCGCAAGTGACGCATGGCCTCACCATTCACTCGAATCTTGTACGTCTTGCCCGCAGCGATGCATAGAGTCTTGAACTCCTTcgcgg
agctgacggcgTTCTTGGTAGGCTTGGGCGCAGGCATGATGGCAGAGTAGTGCGTGATGTAGTGTCGAAAGCAAAGTGGCGAGCGGCAGAACAAACATCA
AGACAAGTGCAGATCGAAATGAATGGCGCGAAGTCACGGAGGTAAATCATGGGTAATTTCGCAGCGGATATTAACCCGAGAATGTTTGTAGTATGCACAG
GTGCAGGGTCGCCAATGCGACCGGcggcttgaagctgcttgtaGTGTTCGATGCGAGCGTTGAGATGGCCGGCCTTGTGAAGCTTGCGCATGGAATTGAT
GACGTTTTGAGATCCGCGGGCTGCGATCTTGTGCTCGCCAAGAAACAACAGGAGTTTCTTCTCAGCGGTTGCACCGATCTCCAGTACATCGTCTCGGTAC
TGCGGTGACTTCTCGTCAAGCACGAAGCCATTGGAAAGAAATagcttcaagaaggccacgaccagcttggcgttggaCCTCATGTGCTTGGTGGCGCCAT
CGGTTGAGCTCCATATGCGAGGCTCTTGGGCGTACCATTAGAACTAGACGTCCTTCaggtttgttgctgctgctgtacgatGTCGCTCTGCTGGTAATTC
ATTGCTTGTGTCCTCACCTGTTTCAGTTGTGTCTAGTGTCTGTTGCGTTTTGTTGTAGACTTTAGCTTCCATCGTAGACAGCCGAGCGTCAAGCTTGTGG
TTGATCTGAATTAACTGTTCAATCAAGGCGGCTTGGTGAAGAAACGTTGCGTGCTTGGTATTATCGCTCGTGCTGTCTTGAGACTTGGTGGTGTCGGCTT
GGGGAGTTTTGATCGAGTAACATGCCAGGTGCGAAGACCAAGCCAGAAGTTCGTTGATGGTGTGGCCTTTTGCACCCACCTTGAGCTGGTTCAGCGATGG
ATAGTTGGAtagtggcgcagcaggtgtGTGACGAGAGTATCAAGCACCCTTCCATTAATTTTGTACTGGGCTATCTTGAGTCTGTAGTACGCGTTGAATA
GCGCCGAGGCGATGGTTCGAATCTTCGTCTGGGTACCGGAGTCGAACGAATCCAGCGACAAGAAAGGAACGCCTTGATCAGGATCCCGGCCACTCAAGAC
GCGAGCGACCTTGTGATCTTCGGCCGGTGTGTTGAAGAAGCGCGCGACGGCCTTGTTTGTCGCTGTTATGTTCCAGGTCTTGTCTTCATCCGAGCGAGTT
GCTTGTAGTGGTTCCGCAGACCCTGGGTGGTCGATCAAGTCAATGAGAGGCGTAGCAGGAGTCAGAGTGGCTTGGGAGTTTGCATGAGGTTCAGGAAGCT
GACtcagcagcgctgccgtcggagaGGCTTGGGTCGCCAGTGCAAGCGCAATCGCGAACAGTGGGCACGTGCTGAAATCGTCGTCAGGAAACAGCGAGAG
GTAATGTTCTTCGGCGTCTTGATCCGCATGAAACGCACGAAGAAAAAATCGCCCGCACCGATAGACAGGTTagccttgcgcagcagcgtaAGGTCCGACG
CACGCCCGAGAAGGAACCAGAGCAAGCACAGCTACGCGGCGTCCTGATAGTCTGCAAAGGTAACAGCAGTCGAATAGATACACCATCatctgcttgagcg
cgttcTTCGTGCACGCAGGAGCTATTAACGAAATCGCCCGACTCTCTCTTCAAGCAATAGCGTTCCAATGTTTGTCCCTAGCGTCTTGTCAATGGCCGCT
CGATGCTGAGGAGACTGGTTCAGCAGCCAGTTCTTGGCCTGTCGGTAGTACTGCATGACTAAGTTTCGACCTAATAGCTTGCCCTTACGTCCCTTCTTGA
AGGTGAGGTGCATGCCAAACTTGTCCACCATAGCTTCCAGGTCAATCGCGgcacgctcgcgctgcatggCCAGTTCCAGGTGCTCCCAACtggcgtcttc
gttctcGAGGAACTTCAGAAACGAGCGCACTGCGGACTCGCGAGAGAGCTTAGTTTTACCGGTGTCAGGTCGTTCAGGCTCATCTTGCATCGGAGGTGAC
GGAGCTTGGGTGTTATTCGAGAAATATGCGAATGACTTGCCATCTGTAGAGATATATCAATAGCTTCAGCGCTCCCTCCGACCCGATACGTCGGAGGTGT
GGCTGTGAGGCAGTTGCGACCtatctgattggtcaaaattgTTCGCGTAGATCAATTTCATTCGCTAAAAG