Description :
From Genome Similarity Track
Location :
Scaffold_1345:297- 5020
Sequence
4723 bases(100 bases per row)
GGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTGAGATCCAACACGCGCAGGAGCGCGAGTATCACCTTCTCCACCGCTCCGTAGTTCAGTTCGTT
TGGCTTTAGCGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCTTCATGTTCTTGTACCAAGGCTGCTGAGACCGCCCAGTCCCTGGAATAAACTATC
ACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATGGGTGTGGTCGCGATCCTGTTCCTCAGCTCCACGAATGCGTGTTGAGCTCGGATCCACCGAG
GCTCTACCCTTTCCGAGTTCTGATCCGTGGTTTTTATCCCGATTGGATCCTCTTTCCTTTGGTCCCGGGGTGGATCCAGCTCCTGTTTTAGGTCCTCTTC
TGGCGTCGTACTACTTGGATCCCTTCGTGGATCTGACATCTCCAGGGCCAGAGCTTGTTGGATTTTGATCCGGACAGCTGGAGTGGTCATCGCAGCAAAA
TCTACCTCTCTCAATTCATATAGTACCGCAGCAAACAGTGCGTAATCCTCGATGAACCGACTGTAGTAATTCAGACTGCCCAAGAAGGATTGCATCGCCC
GTAACGACTGTGGGAAGGACAAGTCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAGACTCGATGGGCTAAGTCATCCACCTT
GCGCATCCCCCAATAGCTCTTCACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACCCTTTCGCACAACTGATCCCACGAT
TCCGCCGGGATTAGAATGTCGTCGATATAAGATCTGCGTCCTAACACAGACGGGGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCG
TGTGATCTTCCCCGGATCCACCCTTTTCGGGTTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATGAGGCGTTGGTAGATCTGGGGTGCGTTCTT
CAATCCAAACGGCATCCGGTTCCACTCGAACAGGCCAAACGGTGTGATGAAAGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCA
CTGGCCATGTCTTGAGAACAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTAATTAGAGGCATCGGATACACCATCAATCGAGTCAGGCCGT
TAACTAACCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGAGATGCCCACGGGGATGACGAGAAACTGATGAT
CTTGGCTTGCAGCATGCCCTTAATCAGATCTGATAGGTTTTCTCGGAACTGAGGCGCCACCTTCCGCACCCTTTGTGCGATCGGTTTCGCGTCGCCGACA
TCGATGTCACATTTGACTCCGCGGGCGGGGGGCGGTAATGCATTACCTATACCAATCAGCAGATGTCGGCTTTCCCAGATATTCTAACATATCCGTTCCA
CTTCCGCGGGCTCGTTTGCCCCTGGATTCACTTGGGATATCGTCAATCGTGTCCTCCTCTGTGGGCAGTGGCACCTCCGGGATTAGCGCCAGGCCATCCC
CGAGATCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAGACTAGTTCATCTTCCGTCTTCGTCGGATCCACCATTGGATCCAAACACCGCGACCCTCT
TTCACCTGGCAGTCCTTCTGTCTTCGTGGGATCTGGTACCCTGGTATCGGGGAAGCCACCAGTTGGATCTAGTCGATCCTCTAGCGAGTTTAAACCCGAC
GGCGCTGGTTTGACTAGTGTTGCCACTCTCGATAAGGATCCAGGCACTTTGCCCCATGAAAAGTTAGGATCCACTCTGGGGTCAGCGGGATGTGGCGGTC
CGGCTTCAGCCTTCTGCGATCCTTCATCCACCGACCCTGTGTTATCTAAAGGCCGACTCTGGGGATCATCCCCGGTCTTGGATCCAACCTCCATCGCTTG
GACCTCAATCCGACGATCCCTCTGCAGTATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCT
CCGAGGGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTTTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATAC
CGTCCTTCGCCAACCATCGTCCGATCTCTTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCC
CTGGATTACGGTAGGCACCCATTTTTCGCCTCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTTAGCCGATCTGGCAGTTCCCAGGTTTCTCCGGGC
TCGATCCAGGTCGTATTATCTGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAA
GTGTCCCATCTGCCAGATCCAACCTCACTCCGGCTGGTACCATGAAATCCATCCCGAGGATGGCATCTTGACCAGCGAGATCTCCAACCCAAATATTGAA
TTAGTACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTGCCATTCGTACGGTACACGCCTTCACCAATCCCCAACACAATCTCGGATCCGACT
CCCATCCACTTGGCACCCAACCCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATAGCTTTTTCATTGTTGAT
CTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCCGGGGCATGGTACTTCCAGTACCCACGGGGCTCTCCTGTTAGCAGATCCATGGATCCAATATCC
TCAGATCCATAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACTTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCC
AGTAACCACGTGCCTCTCCTCTGTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAACTGA
CACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAG
CGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTCTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCA
TTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCTCCGGGATGA
CCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTGGGCTGTCCCGT
CCATGAGATCTCGAGATCTGTACATCCCACGGTCTCCGGGTACGGTATCCCTCGGTCGAGAGTTGTCTCCGGTCTTCGCCGTTCGATCGTTGGACGCAGT
GAGACAGACTTGACGGTAATCTTCAGGGTCGGAGTCCGAAGCGTCGGATCCTGACTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCT
GGGGCCGTGGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTTGCGCGATCCACAGCCCGCAGCACTTCTT
CGAGCTCATCTGCGTCTGGAAGACGTAACAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAAGTGATCCACGTGTTCCCGCAGTAC
CTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAGCGGGGATTCATCCGATCTGCGGCGAGCG
TGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAGCTGCGCAGCAAATTTGGCCACTTGTTCCTGGTGGATCTACCCAGCC
GCCGATACCAATTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCGGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTAACCTT
GCTGATCCATGTTCTCGCTCGATCCTCGTCTTGATCCTTGCCCGTGAACTCCTTCAGATCTGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGAT
CCACCCGCCCCGGCTTCGGCTGTTGCTACCACCGCTGACGAAGGGGATGGTCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTGGTCTCCCTCCA
CTGACTATATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTGGCGCTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGAAACCGACTCATCGC
AGCTTCGAAGTGTTGCTGCAGGGTGCCCGAGGAGGTATCGGAAGAGCCTGTGGCCGGCTGGTCCACTGGCGAGACAGGATCCGTGAGGCGATTACCTTGA
GCCCGATCTGACGATAACCCCACTGGCTTCTTGCCGGATCTGGCTCGATCTTGGCTGGATTGTATCAGATTACGGGTAGGGCGTACTGGATCCCGAGTTT
TCACGTTCACAGGGACTTCTTGT