Description :
From Genome Similarity Track
Location :
scaffold_97:297- 23821
Transcript NameFunction/comments
Pl_109824myb-like DNA-binding protein, putative
Pl_109825hypothetical protein PHYSODRAFT_262124
Pl_109826hypothetical protein PHYSODRAFT_286380
Pl_109827hypothetical protein PHYSODRAFT_509593
Pl_109828hypothetical protein PHYSODRAFT_286379
Pl_109829hypothetical protein PHYSODRAFT_401882
Pl_109830conserved hypothetical protein
Pl_109831conserved hypothetical protein
Pl_109832hypothetical protein PHYSODRAFT_286376
Pl_109833hypothetical protein PHYSODRAFT_524789

Sequence
23524 bases(100 bases per row)
TTACGGGCCACACCTCCGCGACACGCTCTGCGGGCGTGTTTCACATGGAGAATCTCGCCACGTTTGCTTTGCAGAACTGCAATGCTCTCTGTTTCAACAG
CGCTAGCTTCAACCCAATTGTGGGCATCATCGCGCCATCCTCGTTGCGCTTGAGACGGCAACAAGTCAGGCGGTCTGCGTCAAGGCGCAGGATACTTTCA
CTTCAGGGAAAGGGAGTGAGTAACTCCACGTTAATCCGAGGTGTTGCCGACGATCGTTCAAGGACAAGGTCGACATGTCCTCCCTGGCCTTTCCCTCCGA
GCCTCTCATTTTCGCCTCGGTTCCAGCCGTGGCCAGCTCGCGTCAGCTCGCGTCAGCTCGTCACACTTCTGCACGATCAACTGTCCTCCACGACACCACT
GCTCTCGCCACAGTGAGCAGTGACCGTGAAGCTATCGGTGGTGGTGGCGTCTTCGAGTGCTCTCAAGGTGGCTCGGCTCTGCCAGTCCCGGAAATAAGAG
CCAATGTCGGTAGGTCGCAGAACCGGGCCACGAAGGGAGTGTTTACTGACCATTGAGGCTCTGCCGCCATTGATGGGACGTGCCGACCTCCAACGTCGAA
CGGATCGCCATTGCGCTGTCATTCTCAAATTCGCCTCATATCAAGCGAGCAAGAGCGGCGGTGCCAAGCCAAGTGCCAAGCAATTCATCACCATCGACAC
ACTAGAGTCAAGCTATCCATTGCATCATGCCCATGGTTGCTGTTGGATCGAGTTCACCAGTGTCGGCTACCAAGCCAAAGGCCAAGTCCATTTCGCCGAC
GGCAAAAGGAATCTGGTCCTTAGAGGAGCACGATCGATTCCTAGAGGCAATGAAGCTCTACCCTAAGGGGCCGTGGAAGACGATTGCAGACCACATTGCT
ACACGCTCAGTGCGACAGGTGCAGACCCACGCACAAAAGTATCAAGAGAAGGTGTCGCGTCGACTGCGTGGCCTACGCAAGTCCAAGAAGAAACTGGTGC
GTCCTGAACACCGCATTGACGAGGATACGATGGAGTTGTGCAAGTTGGTGGACTGCGCCGCTGAGAAGTTAGTTGCAGCAAGTAAGAAGTCGTCTTCGAG
AGCTAGTGATGACAAGCTAGAGCCGCTGCAGAAGAGTGTGATGAAGCAGGAACCTGTCGAACCCCACAGCAGTCCTCGCGGAACGGATGTGGAGATGAAA
ACCGATGACTTTTTGCCGCTGCCATTCCTGGATTTTGGTGATGACATTGATCTGGATCCTGTCCACATCCCCACCGTGAGCGAGTCACTAGACTTCCTGA
TCGACTACTTGTCGATATAATTCCTGCTTCTGAGTGCCCTTAGTTGCTATAGTGCAGTAGCGATGGGATCAACCCGTCATATTGGTGAGGTATCCGTGGT
CAAGCACACCTCTGGTTCTAAGAGGTGTGACTTTATATTTATATCATAAAGAGCTTTTGCAATACAAGCCTTATCGGTGGAGGCTGCTGGGTCGACAGAG
CAGCTTCGGCGACAGAATCCGAGTTGCCTCCCGACCCAACAGCACCGCTTAATCCTTCGACAACAGTGATTCCGCTCGCAGACCAGGGCGTCATTTGCTT
GCAGTGCTGTCGAGATGAGGCAAACTCGCGTGCTGGTCTTCATCTTCGTCATACTCCTGCTTGTGCGCTCACTTCGTTCAGGCGGCCAAGTTCAAACGAG
CACTCGCTGGCGCAATGAAGTGCCACCACTGTCATGGCAATACGACGCGTAGAGACAAAACATTCGTTCCTGCAAGCCAAATGCCTTCAAGCTCGTCTAG
CTAAGGAACTGGCACGCATCAATAGTTAAATAACAATGTGGCGCGATGCATGCACAGCACATACGTAGCGACGCGCCGATTTCTCAATCATGGTCGATGG
GAACGTCGAGAAATACATGTAGCTCTTCAAGCTGAAGACCTCAACAACATCGACTGCACATCCGGCATATAGGTGGCAGGATCTAGAGGTAGCAACATGT
AACGCGAGATCTATCCTCATCGTCGAGGAGGACAAGGTCGAAGAGCATCCGACGGTCATCACAGCGATGTGCCAATCAAATGATTAGCCTGCTGCATCCT
ATCACGCGATGCGTGGCGTAGCCTGGTCGCATGTTGTGTGACCAGGATTTACTTGTCAGCTTCGGCTTGGCGGCGATCGCAGGCGATTCGTAGGTTTAAC
AGCGATACCAGCACTGTCAACAATTGGAAATGGAGTATGATGGACAGCTTTGCTATTTTGGATTTACCCTTTGCTCGCCTTGGCTGCTGCTTTCCTTGGA
CGAGTTAATCTCACCTACATACATGTAGCGTGTTTACGTTTGGGGAGCCTGGTCGTGTTCACCAATATCAGAGCATTGATAGCACATTTGTGTTGAATGA
AATGAATCTCGGCCTCGAGAGCCGGTCGTCCATCGAGTCAAATCGCAACGAACGAATTGCTGCAAGCAGCAGTTCGTTTGCAGTTGCTACTCCATTGAAG
CTTCATCAGATTCAACTCGCACGGCGAGTCTACGCCCGCTTCAGCTCGGCGTCAGAGAACACGGGTTAGGAACGACTGGCGCTCCATGGTCCTCACAACC
CGACTGCGTGTTGTGCAGCACAGCCTTTTTCGCTCTACCGTCACGCTCTATCGCCACTCGTCCGAGTAGTAGCTCCTCGGTGGGAAGTCCATTTGGAACT
TCGTTTTCGCTACCAGTAACCTGCATTACGCGTTCGTGCAGATAGCATGGCATACGACCCCTACGCCCATTTTGCCGAAAGCTTGAACAATTGCTTCGGT
GGTATCCATCCTACCAACCCAATCGCCTCAGAAACATCAAAGTCAGCTTGGGTGATGAATCACCAACCCGTACTTACCAGTGATCTACATGAGCTGCTTC
TCAATCCCCAAACATCGACTCGATCTCTTCCACTGAGACGTCGGCGCAATCTCCATCCACACGCCCCTGAGCGATCGCCTTGGTTTGCGCACACAATTGC
TCATACTACTATTACGTACACAGCACCGTGTACTAGAGCATCGTGTACTAGACCACCGTTCACCAGAGCGTTGAATATGCGTAGGCAATGACTATTTCCG
CGCGGGACTCCCACGGACGTTCCGCCCAGCGTTATCAAAAATTCCGACAGTGCACCGCTGCATGGACACGCAGCGTCCGACTTGACTCAATTATGTATCC
ACGACAATTTTATTTCGGTACTGGGGGGGTCAGCAAGTTGCTCCATTTTGTTGACAGCGATACGAGCGTAGTCTTGTGCCACTAACAACTACAGCGTGTT
GACTGGTGAGTGCTACGAAAGACGTAGTAGTCAGTGTGATAACCACAGGGTTTTAGCCACTATCGATCACGTAGTTTCTGGTAAATCAAGTACCAGAAAC
ACAAATAAAGTTAGTTTTGCGTTCGGTGGAGTTTCGGCCTTACCAGAAATCGATTTATACACTGGCGGGATAACAACGGAAGAGAGAATTACGGCATCCA
CGAACGCACTCCCATATATTAAACGTAGTAAACAAGAAAACCTACTACAAAAATAGCGTGTAGTGTATTTCATGCTTCGTTTTGAAGTAAATCGGTGATG
TGAGTAGTTTGATAAGCGTTTTCGCTTCAACCTAGGCAAGTCAAGAGTTGTGTACGGCACGATGTGATCGCGGTATCGGTGCTAGTCATTAATCCGCTCG
CCTCACTTTGCAGGCATGCAGGCTCTAGCAATGATCGTACAGCCTTTAGTACCGAAAATCATCACGCTTGCTCAGCGTTGACTCAACGTAGAGCAAGAGT
TCCATCACATCGTGGTAAGCTGGTCAAGTCAACTTTTGGTCTCACAAAATACACAAATCACAAAATTCAGTTGTTATGATGCTTACCAGACCAAAATGCT
CTAGGTCATTAGATCGGGCACCGAAAGCATGGTCTTGTCCGCTCGAAACTGATCCTAACTGTCGCGTCAAAAGCATGCAATCGAAGTTAAAGCACTTACT
TCAATGACCGCTGAAGGATCGCGTCTTCCCCTTGTAGGCAGCTCATGGATCACAAACAAGCATTGAACGCGATTCAAGGGGGAAAAGCGTATAAATGATA
TTATCTCTGCATTCGGTTCGCTCCTCCGAGCAGGACTTCTCTTGAGGTGTTACGGATTGCCACATTGGCGCAATAAATTAGGCAAGAAGCAGGTCGATGG
ATTCCTGCACGTCTTGTCGGTAGGCATCATCGGCCAAGACCTCGTCGTAAGTTACTCCGGTCACGTACGGCAGCGGATCCAAGTCCAGGAACAGAGGTTT
CACATCAACATCAAGGTCCATAGCAGCAAAGCTGGAGCTGCTGCTGCCGGCATCGCTTGCCACAGGGCTGCATCCGCCCGTTAGTAGCTGTCCGAAGCCG
CAGCTGAGTGGAGACATGGCTCCAACGGGAAAAGCCGAAGGTGAACGGGGTGATCCCTGGACTGTAAAGTTCTTTACGCGCTGGATGCAGCCAGTGGCGT
GTGCATCCACACGGTGCTCGGGGCGCACAAATTTCTTCTTCTGTTTGCGAAGACCACGTCGTCGGCGATTGATCTTTTGCTGGTACTTCTGCGCATGCGT
CTGCACCTGCTTGATCGAGCGCGTGCCGATAACGGCAGCGATCGAGCGCCACGGGCCCGTTGGGAACATCTTCATCGCTTGCAGAAACTGTTCGTGCTCC
TGCTCGGACCAAAGTCCGCGGGTCACCGGCGTAGCGGGAGCTGCCGGGACGATTAAACTGCCTCCGTGCGTGCTGGCGGGCATCATGATCATGGCGGTGG
TCGCTGCAATGGTTACTGCGGTGGTGCTGCGGAGTGCGCGGCTCAAGCAAAATTCGGAAGTGAAGCGAACTGCGACCTGATTGATGTGATTAGGCGGAGC
AATCTGGTCATTTTTTTAAGTCTTGACACGGTGTCTCTTCTGCGTGCGAAAACGAGGGGATGGGCGCTTTCGAGAGCGGGTAGGGGTAATTTATGGCTCA
GAGCGGTCCTCGATGAAAAAATTGACCAATAGCAGCTGGGCATCCCGCCGGCTCGTCTGTTCAGTTCCGGTACAGTGAGCGCGGTATCTCACGAGCACTA
AAATTATCGGTCGGTAATTTATGCGCGCATAGTATTTGGCGAGGTGTGAGAACTGACATGTCCGCAGGCTGCGACCGGCAGCTGGTCGACGCGAGCATGT
GCGATGCTCGGCGACTTGAATAGTGAAAAGCACCTGCGGCGCGCAGTAGTCGCGGCACCAGGCGAAATACAAAAACGCCGCGGACTAGTTGCGGCTCATT
CTAGGCTATCCAGCCATGGTAAGGTCAGAGAGGTGCGTGCTGTAATTCGGCGTGGTAAAATTTGCACTGCCGCACTAAACGAAGCGGCAAAACGCTTGCG
GAGATGTCATGCATTTCGGCACGTTCTCCGCTCAAAGAGTAACTGAAGTATGTGCGTCGCACTGCGGCTGAATGAGTATTGGTGTAAAGGCTCCGACCTG
AATACTTTCGCGTCGTAGTTCCTCGTACGCGTATGTTTGCTCCGACTTGGGAACTCTAGACGTACGGAAGATCCAGGCCTCTTCGCCACTACAGCGCAGA
CGTCGGAAAGCTTGGCTCGCGATGATTGCCTCCGGCTGAGTTTCGCTAGCTCATCGCACAGACAGCAGCATTTGGAGCGACCCGCTGTCTTATCGCATAT
GTAGTCTTTGGCGCGCCATGCGCCAAACAGTTTGTTGCGACTGCGATAGCCTTGGAAATGCAAGGAGCTCCACCATACCACAACCAATCCCTGAAAACCA
ACTGGGCGAGGTCAGCGCAGCGGCACCGTCACGGTGGCGCAAAATGGCGGCACATTCGGTAAGATAATTAAATTACTTCTTCAACCTCTGCACGGGAATA
CATGCGACACCTCCATGCCGAAGCAGGGGTTTGCATTGGCGGTGCTACTCGCCAGAAAAAGATCCGACCAAACCCGGACTAAATGGTTTTTTGGGGCGTT
GAAGCCGTGAGCAATTTCTGTTTTTAACAGCGCGCTTGACCAACGGCAGTGCTCGGCCTGCGAATGTGACGCCGTGTCTTCCTTCGCGCGCATTCCTTTC
GCAGGCTCTTCTTTTTCCGCCCTTCGCGCAAGGCTTTAGTCCAGCAGAGTTTTGCTCGTCGAGCGTTGTGTATGCGACACCAGTTTGCATGCTTCCTTCC
GCGTGATGAGGCAGGGAGCCCGTCGGTGAACGAGTCTCTTGTAGCGATGCATTTTTTAGGTGGATTCCTGCTCGTGTGGATCTGGCTGCCGATGCAACTG
AGCGAGCATTGCAGACACCAGCGAGCTGACAGCGCGCTCTCGCGAGGCTCTCGCCGCGAGCCTACCATCGCAAAGACGCCGAGATCAGCGTGAAGGCTCG
TGTGACCGTCGAGACTTCTGGACTCCCAGCGAACTTTCGTCCGCGTTCGTGGGCAGTTGGGGCCCTACTCGTATGTGTGTGCCGGAAATAATTACGGTAC
AGGCGTTCGCAGTCTCTTCACCCGCGTGCCCATCCCCTCGGGACAAATCTTTTTTTGTGGGCCCGCAATTTTCGCAATGCGGCGGCGGAACGCTGGGTGT
CGCTCTTGTGTCGGAGGTCATGGCTGCGTGCGACAGGAGCCGAGACGGAGCTCGAGCGCGGAGGCGAGGACGTGCTGCCCGCGCGGTGGAGGCCACGAGG
TGGGGGTGGCGCGCAGCTTCTAGCAAGCTGCTCCCGCAGAAGTAGCAAGAGAGATCAAGTCGCTGCAGAGCTGTGGCGTTGTGATGCTGTGGCGGGCATA
TCTTCCGTGAAGATCGCCTTGAGGTAAGAAATGCCCATGGCGACCACGTTCGAGGGCGTTCGGCGACGAATTAGCTCCAAGACCGTATTCAGGACTGGCC
GGTTGGCTGCAGTTGCGACTTTCCGACCGCGGGGCTGTCCACCTGAGCCGTCTGCCTGGAGAAAACCATTCGGTGCGACCGCGGACTCCTTGGTGGAGCG
CTGAGCATCAGACGACAAGGACAGGATTTGTCACGCTGCGGCCGACTTCATTTGTCTCAATACCAGCGTTATGGAATGTCGGATGCCAGCGCTTACCAGT
TTCTGTGACGGAGTTAGCTCAGTCGTGGTGGCTGAAGGCGATGCTGAGTCAACAGCTCTGTCAAAGCTAGCAGAAATAAAATGGCATTAAATCATTAGAC
GTCGCAACGCAAACCGCACAGTTCTCGACCACATCCTCACGCTGCTGCCGACTTTCGACGCTGTTTAAGCGGCGGCTCGTTCACAATAGCCTTAACCTCT
TCCGTCGCCTCCTCCTCCATCGTCACTGCCACACTCTTCCTCTTTAAGCTCTTACGAGCCTCTGCCGCCGCTGCACGTTTATCAATTTCAAACTCGAAAC
CCACAGGGGTCGTGAGCTTCGGACGTCGAACTACAGGGACGCCCACGCCTCCATTAGCCGAAAGAGTTCTAGACAACTTCTCACTCCTGCCTGGCACAGC
TCCATTGGTCGTAGCATCGTGATACTTTTGCGTCTTTCGTTTCTGGGCCTGCACCCGCTTGCGGATAGCTGCAATCTCCAGCAACTCACGGGAGGTTCTC
GTCAACATGTCTGCACGAGATCGGGCCGTGGACTTCTTCAACTTATTGAACTTCGGCGATTGCGGGATCGTCAGACGTCCGCTCTCCTTCGCCACTCGAG
CCAGGCGACGTCGTTTACGCGCTAGTTCATGCGCTTCTGCCAGTTCCTTGTCCTTACCAGTCAGTGCTTTCTTCCTTGACGCAGCTACTGAGGCCTTCGT
GGGTCTCAAGAGACGAGCAGTGGACGAAATGGGGCGAATCCTAGGCACAGGTGCGGGTACGCCGCGGTACAGTGCGTCTGGGTCTTCCTCGTACACGGGG
CGCTTCGTAGGCGCCATCCTGTCGGAGCAACCTGCTGCACCTTTCGATGTTTTCTTAACTGGAGCCAGCGCGGGAGATGCCACATACAAATTCCATGAAC
AATTCAAAATTCAAATAAGAGACTATCCACTAATCATATTGTTTATACGATTTTCTGCCAATGAAAAGGAAGGTTATTTCAAGTTGAAGCACTTCAACAT
CGTGGTGCTTTTCTCTTGGTCAGATGACCATGCGCCCTGTGCCTCCAGCACGACCTCGACTCGCTGCTTCTCCCCAGCAAAACAACGTTGATGCACCTAC
TGCAGTTCAGGCATTGCATGTTTCGATCCCGCTTAAACCGCAACAAACACCGGCTGCATTACCTCCACGATTGACTCAAGCAGTCAAAGACGAGTTCGCC
ATCCGCTACTTGCAACAAATTGGAGCCAACTCTACCCCAGAGAATATTGCAATGGTGCTGCAACATTTGCCCGTGGAGAAATGTGCCGTCTCGGCCGCCT
GGAAATCGCGCGGGTCATTAGCCGATGTGTTGGCAATTGATTTAAGTCCCAAGTCACTTATCCAGACCGGAGAAGCTGGTGTGGCAAAGAACGAGACAGA
TGTAGCTCCAGTACCAGCACGGTTGTCTCCGAGACGACAACTTCGTGGCCAGCAGACCCGCCATATATTTCAACTTGGGACCGTGTGCTTCACCTTCGAC
GACATGAAGCGTAAATTCTTACTTCCGTTCAAGCTTGCCACGCCACCACCAGAAATGGACGTGTTGCAGCTCTATGGAGCACACTTGGAGATTAACACAG
ACTTGGAAGACTCGTTGTCGCCCAACCAAGTCGAGCAGCTAGGTCCTGTACCTGACTCACCGACAGCTCTACTCAGGTGGGAGACGCAGCGACGACACAA
ATCTGTAGACGAACGTCAGGTGTCACCGATCGCAAGCGCAGAAACGGTGTCGGATCTACACAACGAGTTTTACCTTACGCTGCCGTTGGTATCTCTAGGG
GTGCCCGAAGGCGACGAAGACACACGAACGGTGCTGTATGATGCTCTACAAAGTTCAGCAATGATAGAACTCGTCCAGAACACAGTACGATATCTCTTCC
TCACGCTAATTCACCCAGTGGAGAAGAGACGCAACTCCCACGAACAAGACGTACTTTTTGTCGCTGTTGCTCAGCGTTTTGCCATGCTTCGAGCTAAGAT
AGAGCGCAAGCAACGTTCGACTCCTCGACCACAGCTATCAGTGCTCGTGCCGCTCTTACTACTCGCACTCCGTGTAGACGTTGAGACGCTAGTTCGGTTG
CAGTATCCGGTAAGCTTTTCATGTGTTGCAGAAGAGATGACTCGACTACTTCAAGTCCTGGATGCTCGGATCTCGCAGCTACTAGACCCCGATGCCAACT
GGAGTCGTCTAGCCGTGCTGGAGACAACTCACGAGGCAGGTCAAGCGCGAGCATCATCCACTTTCCAACATGCACGTCGACAACTACGCCTGCGAGACCA
ATTCTTCCAGACGAGTGCTGTCCTGCATGGCTTATTCCCGGAACCTTCATCGGGTAAATCTCGTCGTGTAATGACTCTGCGCGGCGGTGCCGGGATCAGC
CACTACCCAGATCTCTCCAGTGATCCCTCTAAAGCTCCCTTCATGCACTACTCAACTACACAAGAATATGGGTTGCCTGACACTGTATCTGTCGCCTCCA
AACTCTCTCTCCTCCGAAGTCTTCGACGCTCCCAACAAACTAGATAGACGACAACAACAAAAAAATGCCACCTTAACAACGTACTAAATCAAATGAAACC
TCATATTCTTCCTCATGACTCAGAAAAGAGAAGAAACTTCCGTGTCAAAGGTGACAAAGTAGAGACTTGTTTACTTGGTGAGCTGCTCCCAGAGCTTCTC
CACGTCGCCGCGCGAGTTGGCAACGACAGTGCGGCCGTCCAAGGTGATGACATCGCCTTCACTGTTCACAAAGACGAGCATCGGGATACCCGTGACGCCG
AACTTGGTGCTCATGGCCTGGTTAGCCGCGCGCTCCTCGAAGGGAAGAGCCAAGAACGGCATCTCCCCGAAGTACTCAGTGTACTGCGACGGGTCACGGT
CCGACGAGATGAAGATGAGCTCGAACTCCGGGTGCTCCTCGACCATGTCGTCGTACACGGCGCTCAAGAAGGGCGTGAACTGGCGGCACGGCGGGCACCA
GTGCGCACTGAAGTAGAAGCCCACCACCTTCTTGCCGGCCAGCTTGTAGTCCGTGTCTTGGAGACCGTCCTTCGTCTGGAGCTTGGCGCCGAGCTGTTCC
GACCACTTCATTTTAATTAGAACTCTGGGGTGGCGACTCGATAGCGAGAGATGAAGTGAGGAGAAAAGTGAGGATATCCAAGGGGTACTGTGACAGACGA
AATAGTTCGAGTTGTTAGCAGAAATTTACGAAAGCGGAATAGTGAATTCAAGTGACGCTATTGTGACTTTTGCCACGTAGACCTGTACTTACATTGTGAC
TGGCTGATGGTGTTTCGTAATCGAAACGGGTAGGAAAAATCAACCCAAGAGTACCGTGAGCGACAACATTGTTGAGGAACGAGCCATTGTTTACGAAAAA
TAGCAGTGCATTCGTCATTAGGGTCATCAAAAAGTCGTAGTTGTCTACGTGGAGATGTCCACAGTCGTCGTCAGCAGCAGCGACTGCACGAACGCTCCGA
ACGACTCGCATCCTTTGAACTTGTATGATGTATGCACGTCTGTCGGCCTTTGTGTTCTGCATCTATTCCTCGGCAGTCGTCTCCTGCTCCAACTGCTTCT
TGGCGTTCTTCTTGGACGAATAACGGGTCAGAGACTTCTTGGACGGGTCGAACTCGCGCAGAATTACCGTCAGATGCGTGTATGGGTGGTGCATCACACC
GGAACGTCCTGTAAAGCAAAAATTAGTCATCCCATTCTTCTCCCAGTAAAAGACTGAAGCCTACACACCTCGACCCATGATTCGCAGACGCTTGAGGTAG
GTACCCTTGTTCACGAAGCACTCGGACACCATGAGGTTCTCCGGTTCAATCTGGTACTTGATGTCAGCAAGGTTAATGGCATTCTGCACAGTCTTCTTGA
AGATCTCGGCCTTGCGCTTGGGTGAGAACTTCATCTGCAGGATCGCTTCATTAGCCGAAAGTCCACGGATCTGCTGTGCCAGGTACGTGAGTTTGCGGGG
ACTGGCACGGATTGCGCGCTTCACAGTCTTGACGGTGCGAGGCTCGGCGGGGGACGTGGAGTTCAGGAATGCAGCCGTGTCATCGTCCGAGGCGGTCTCG
CTCTCCACAGCGGTCGTGGACAATGTCGCCCGAGCTATACGGCCCATGAACGCACTACCGGCGGCTGGGCGGAGCGTCAGCGCGCCCATCTGCGAGCGTA
GCGAGGCCAGCATCGTGTCCGCTGAGTTGAATACAAGGTCTCTTTGCTACCACACATCGATATGGGACCTGTAATAATCGATATTTATTTACAGAGGCTT
AGAATTTTAATGTCAAAAAATTGAAACGTTGCTTGACTATTCTTTTAAAAATTTAAAAACACTTGGCTACATACAAGTTGAAGCGATAAAGCAATGGCTG
CTTTGTGCAGCTAATTGAAATCGGATACTGAAGCCCTTCAAGGCTCTCTAACTAATTGGTGGAGTGTCACGTTCGCTAGGTAGGCACGCCTTGATAAATG
ACTGAAGTTGCGAGATGCCTGCTTGGTTTTGTCCCACACGAAACGCTTTGACTCGCTCGCCTTATTGCTTTGCTTCCCACATCACCACATGCAATACCTC
ATCGGTCTCTCACGCAAACGGGGAAGTGGTGCGCGTCTTCTTGTCGGAGATCCAAATGCGCAGCTTCTCTAAGTTCTCGATGGGACCATCGTGCTCCTCT
TCGTCACCGCTGCCATACGCACCGGCACTCATTCGATCTACGCTTGCTCGACTAGCAGCGTTAAATTGATCTGTATCATCCGGTAACCATTCAATGTTCA
CCTCAATGTCTGTTCTGTTAGACACCAGCGGCATCAAGTATGACACGAATCGCTGACGAGCTGTGGGTGGAAGTGATGGGATTTCGATGCCGCGCACTGT
GATCTTCGCCGCTGCAGTACCCACTACAATGTTGGCAATCCACTCGCCCAAATACTCGAATTTATCGGGTCGTCCCTTGCAAATATCTCGGCGTAGTGAC
AAGAGGAACTCTTGTGTGAACTGCTTGCACTTCTTCTGTAGTTTATACTGCACGATGGCCTCGCTCAGCGCCTGCATCTGCTCCGAGTTTTCCATACCGT
GAGTACCCAAGTCATAGCACTCGCTGCATAGGTTGTAATTTGAGCATACACTGCAAGTCCAGAGTGCACCTAAGATCGGGTCCATGCCGCAGCCATCACA
GAACGAGTTCGGATGCACGATGGTTTTCTTGCGTTTCCATTTGGAACCAATGATTGACGCTCCTTGGCTCATTGCTGCTCCAAGACGACCCATCAGAGGC
TTCGTAGGCGACTGCTTCTTGTCAGGCAGACTCTTGGATTGCGTGCCATCCTTGTCGTGCAAGTCGCGCTGAAAAACGAGCGTACGTGGAACGGTGGATG
TTTGTATGATCTCGAAAACCTGCTCCTTCGTCATGTGTGGCTCAATGTGCTGTCCATTCACGCTGATCAAATAGTCTCCCACTACCACACCACCACGCTG
CGCAGGGCTGTCCTTCTCCACACTCCAGACCTCGACTAGCAGTTCGTTTTCCAACGACACAACAACGTTCGTATTGAAGCCCAGCACTGGTTCAGTAAAC
GTCAACGTGTACGTGTTGAGTGGATGCTCTACAAAGTCAGCCTCGGATTGTGAGCGCAATCCCGTTTTGGAATCTGGCGCGTGAATCGCACTTGCACTCG
AGGAATTCCGTCCAGAAGACTCACCACTGCTCGTCAAGCTACCCGAACTTGCTGCTACCACTGGAGCCTCGCTAACGAAACGAGGCGGTTTGTCATGAAG
AGCTACACGACGCAAACTGTGCAGCGCACGAACAGAAGATGGATCTGAGGCGACACTTGGACCCAAGAAGCGATGCGACGCGAGTTCGTCTTGGCCCTCA
CCAAAGTCAGCGGCACCACCATAACCTAGCGGCGTTCCCAGGTCAGCGCCTTCCTCATCATCTTCACCTGTAGCTCCTTCTGCCTCATCACTGTCGCTGG
CTTCATCGTCAATATCATGATGCACTAAATTCAATGGAGCAGGTCGTTTCGGTGACGGGATCACCAACTCCACTTCATGCTTCCTGAATCTCCACTTCCT
GTACCTTTAAGTTCTACTTCACGAACATGTACCTCCACTTTCTCCACATCATCAATTGCAACAGACCCAGCTACAGGAGATGACACGTCCTGCTCTTGAA
AACCAGCTTCCTCAAAATTCTGTTCTGGTGGCAGATCCACAGGTGTCGTCGGCTCTTGATGATCCTCTACAGGAGTAGCAGGTTCTGTGTATTCCTCTGC
AGGAGTTGTAGGTCCCGCACTCTGTTCAACAGGCGTCGTCGGCGCCTCCACAACTTCCTGCACAGTCTTCACCACTTCTTTGTGCAGCGGCTCTTCGTCC
TCGTCGTCGCTATCAGTTCGCGCCTTGTCCGACTCAGCGCCGTCCTCATGAGGCTTGTGGAGCTCCTGTTGCTCCGCTACAGGGCATTTCTCCTTCTCCA
CCTCGGCCACGTCACTCTCAGTGGGGGTGGATGGACTCGTCGATACAGTCGTAGGTTCTCCAGTGGCGTGGGGCGACGCGCTCTCCGCAGCACTAGCCGA
CGTCTCCATCTTCTGCTGCCGCGGTGTAACGAATTGTGGGGACGACTTGCGTTCAGTATTGAGGTTGTCGTCCCTTTGCTGAAAAGATAGTCGAAACTCC
GCAAAATGCCAAAAGTCGATACCTTTTTATTCGAGTATATCAGAAATAAAGAATGATCTGATCCAAGTCGTGAATACATTATTCGACTTCAGTTCATGAT
AGTCACGAATATCGTATATTATAGTCTTTCGAGGGTTTCGTTCTGAAACTTTTTGAGTGAAAATTCATTATAAACTGTCGTTGTGCTCCACTGTTTGGCA
CAGCACCAGCTAAGCATATGGCTGGTATCGCATGGCGGTCACGAAGTATCGAGTCTACGTCTAACCGCATGGATGGCTATTTGCCTCCGCCTATTAGATA
TACGTGCTCGGCGACATTTCGACAGATCAACGATCTCGGAAAATAACGTGTTGTATCGGAAACTGCTGGAAGCTTGCAATCTATCTGCTCCAAAGTCGTC
CAATGAATGTAGCAGCAAATTCTTGGGGACAAACGTCCCCTCTTGAGTAATGCGCACTTTTTGTTGGAAGGCACTGCCACGTCACAGAAATCTCGATGCC
ACCAATCACTTCTTCGTATTCACATGTCATAATACCAGCGCAACTTCAACTTGTACAATTTGTTGAGACCTGTCCACCGGTCAGCGATACCTTGTCACCC
ATTTCTGCCGGTGCGTTTCGCTTCTTTCATCCTCTTACCCCAGGAAATCAAGTACAAAGTTGACGATGTTAGCACGAGAACTTGTCACTTCGTAGTCACC
ACAACAATTTGAATCTTTCAACTTGTAACCTCCTGCAGACTTTGAAACGGTGCACTCAGCAACATGCTAGCTCTTCGATTGCTGCTGCATCAAGGCGCAG
AACTCGTCGTAGTCAATCTTCCCGTCCTCGTTCTTGTCTGCTGCCTGAATAATCTTGCAGCTTTCCTCATTGTTAATGTGCTTGTTGCCGAGAACATGAA
GGATGTGCTTAAGCTCGCTGCTGGTAATGAACCCGTCGTGGTTTACATCGAAGGTCTGGGCAAAGGGAGCACGCCACATCAGTTTGAGAGGCATTACAGA
TTCTAGGCTGACTTTCCATACGTACATCAAAAGCTGCCTTGAGATCTCCAGTCGTCAGATCCCCCCTACAATTTGAGCAGGCCTTAATATGATTGTCTGA
ACGAGTAACCAATGATGTGTTCGTACCGACGGAATAGTCGTTGATTCATCATACTCACGAACTCAGTAAATGAAATCTTGCCATCGCCATCAGTGTCTGC
TTGTCGCATGATCTCGTCAATCTCCGAGCTAGAACCACCATCGTTTTGCATCAGTGAGTTTCCACAGATTGCCAAAAGTACCCAGAAAGGTAAAGAGTTA
AGCAAACCTTGAAAGTTGTTGTCCCAGTGCTAATAGCATGCCTTTTAGCTCATCCCGATCGATGCAGCCAGATTCGTCTTTGTCGAAGAGAGCAAACGTC
TCCTTGAACATGTCCATATTCACCGTTGATGTCCGGTGTGACGAGAGGTGTCTTTCACCAGCACCGGAAGTCTTACCAAGCTTTGCATGTTGCACACCCA
TGACAACTGCCAAAATGTTAGCTCGAAGCTGTTGCAAGCGCTGATACGATTGTAGTCGTTGACTATGGCCGCTGTCCAGGGGATCTGCAGGTGTAGTGAT
ACCGCTGAGCCACGAATGCTGCAGTGCTTGCTTGGCTGTCAAGCGTTTCGATGGATTGGAATCTAGTAGCTGCGTCAAGAAGTTTTTTGCATCTGGCGAG
AGGTTCTTGTACCATTTGTTATCCACTGTACATCAGTATTCATAGCCAAATATATGTGGGTTTCATTCAAATGCAAGTAGTGAACAATCGAACGCACCGT
CGTAGTGTCCTTGTGCGATCTCCTTCACAATCTCAGCATCGGACTTGTCACCTCGTGGATCGAACGGGTGTACTCCTGTGAGGGTAATGTAAGCCTGGAG
CAGAACACATTGAATACCTCAGTTGGTACACTGAAGCAATTGATACCAGTATTTTCGGTTCTTACCAGCACTCCGAATGCCCACATGTCAACACTGAAAT
CCTGAGGTTGTCGTGTGATGATTTCAGGTGCCCAATACGCACTACATTGATACAAAAGTTAGTTGTTACGATCCACCGCTATTGCTTGCTGATTCATTTA
TACTTACACAGTTCCATTTGGGAACTTCTCGACAATTTGCTCTCCCTGGCGTTGTCGCCGACTTAATCCAAAGTCCTGTATGCGTTGAAAACACAGATAG
AAAGCCAAAAGCATAGCATCAATGACTTGCCAGCACGATAACGACAGTGAGTCTTTCTTACCGCTACTTTGATGTTTGCCTTGGCGGATCGATCTGACAG
CAAGACATTCTCGGGTTTTAGATCGCGATGACTGTATGAAATGTAAAACCTATGAAAATACGGTACAACGTCATTTGTCAAGCATGAGAACCCACCAGAC
ACCTCGAGCATGCACGTAGTCAAGTGCTTGACAGACATCATGTAGCAGATGAGCAGCATCTTGTTCAGAAACAGATCCCTGTTGTGTAGTAGTGTCATAA
AACAAATGCCGCTGGTCAGCTCATTGGTAGGGATGCTTTCGTCAGTATATCAGTCCCCACCATATCGACGATATAGTCAAAAAGCTCTCCTCCTTCAACT
AGATCCGTCAGCATTATAGTTTCGTTCTTGAGATAAAGTACGTCGTGCAGCGACACAATGTTCGGGTGTGCACCAAGGTGCCGCAGAATATCGATCTAGT
AAACAAGCCGGTAATAACCCCATTCAACCACGAATGATTTCACAACTCCATGCAGTAGCAAGTACCTCAGCCTGAATCGTCTCCATCGACGAGTTCTTCG
GATCAAAAATCTTTGCTGCCAGCATCTACCAAAGTCAATCAAAATTCAAATCGTCAACAACGTCAAAGTTCCTTCACACACCATAACAATTACCCACCTG
TTCAGTCTGCATGTCAATTGCAAGACGAACAACCGAGAACCCTTTGAATAGCAAGCTCTTTAGTTTCCAACACTTCTAATACTTTACTTTCCAGCAGAAA
ATCCTTCGAACCTCCTCGACCGAGCTCTTTCAGCAGTGTGTAGTGTCCTCTCTGCTCCAGTTTAGAGTTCGCCCACCAGGCATCACCGCTCGACCCGCAC
TCGACGTCGCTACTGGGTGTGTCCCGAGACATTAACATAGCTACACCCAATGCTGCCACTGTTGTCACAACGCCCACCCAGGCCGTTCCATTGCCATACG
CCGTCCCTTTCGACTTAGGAACATGCACGTTCTCTACCGCTGATGTTGGCGCCATCTTCGAGCGCACAGGCCCACGCGTAAGCCGAGTAATTAGACGCAT
CCGCATGGTCGTCTTGTAGGGTGCGGAATGGGAACTGAACTGATTATTGAAGGGTGTGTTGAAAGTAGCTGTTAAGTGGTGTAAGTAACTGCAAAGTAGC
ATGATGTTGAAGTGGTAGCTGAAGTGAGTCATCAATGAGTCATTGACAATGACGTAGCATGCTGCGTGGAGTGAAAGGGTTGACCTCCTCCTCGAACAGA
TCGGAGGCGAGCTTGGACAATGCGTGCATGGCTTTAAGGTCTTCCAATGAGATCTTCTCGCGGGCTTTGTCGTCTACTGTGCACAGACAAGCGACGACGG
AGCCATCGGGTGACTTGATGGGGAACCCGGCGAAGAACCGAACGCCGATGTCTCGAACAAGTCGCAGATGACGCAGTTGAGGGTCACGCATGGGATCTTT
GATCACGAACGGTTTGCCGTTCGCTACGAGAGGGAACGGACAAACTGTCACCTCTTCGGTCCACGGACGTGGAGTACCAGAAAATCCCACAATTCGTTGA
GTTTGCGAGCTGTGAGAACTGTTGAGAGCTACAATGTACGCTATCGAGCAGCGCATGCGAATGGCAGCGACTTCGCAGATCGAGTCCAGAGCTGCAGAAT
CCAGGTCGTCATCCAAGTCCAGCTCCGTCTCTAGGTTCGCTGTTGTGGTCCAGGGTCGAGGCACAACTGAAGGTCTTGAGTTCATGTCCAACTTCACTGA
CGAGAAGCACTGGCCGCTGGTGCTTCGTCGCCGACGCTGTGTCACTTCTTCAAGATTGTAGAGCGAGCTTGACTGCCTTCGAGGGATGTTGTTTTCAGCT
GCAGTGGGGTCTCCACTCAGTGAAATATTTGACAGATGTAGACGTGCCTCCAGATACTTGTCCACCATCTTCTTGTCCGGGTGCTGCGGGTGAAACACTG
GAACTGACGAGTTGAACGTTGACGTTGACGACGATGTTGAAGTCGAGCTCGTTGGTGCCGAGCTGGATGTCACTTGCTTCACCACTTGACGAACGATCTC
CAGCGCTCGTGCCCGTGTCAATGGGTCACTCGAGAACAATGCGTCAGCCAGTTGTCGTCCAGATGTCGACGAGAATGACGCCGATGCTGTAGCTGCGCTG
CTACTGCGGTCCAATCGGTGCATTTGCGCCTCGTATACCGTCTGCGAAGCTGTTGCTGTGTCCGTTGAGTGGGAATTGTGAGTGGTGTTGCTGGGTTTGA
GTAAGATGTCGTAAAAGGCGGTGGATATCTTCGTGCCGTATGTGTCAACCTCATCCTCTCGATCGTCCGCGTCGTTTCTAGTTCCAGTCGTTGCTGCAGT
CGAAACTCTAGGAAACGTTGCATGGAGTAGCGGGTTTCCTTGTTGGAACACGCTAGCATCCACGTTGGCCACGCAGGCAAAACAAATTCGATTGCGGCGT
ACTCGGCGCGCTATAGGCTCCACATCAAACTTTCTCGAGCATTCACGGCATACTCGTTTGGCGCAGAGTTGGCAGAATCGTTGAGGACGAAGCAACCCGA
ACGTCTTTAGGCACACGGAGCACCTGTTGCCTTGCTCTGCCTCGCGATTCACAGGAACGTGCAAGAACGGTTGGTACCCCAAACGGCGACGGCGCACGAG
TTGCTCAAACGATGTCGTCGCAGCGGCCAGTAGGTTCACAACGTACTTGGCCTCAGCGTTTGCTGTCGGAGGTGCATAGTGCCGGATAGAACCACCAGGA
TGCACCTGGTCCCAAAACCTGGGTCTTGCTCGTGATGCGCTAGTGGGGACATCGGTCGATGTCGGGGGACTAGAAACGTACGCAATCATAACAACTCGCG
TCTGGTGTCCACTCAAGTCACTGTACGAGCTCGAAACGTGATACCCAGCGGCGATATGATCCATGCCACCCCGAATTGCCTGTTCCGAGGCGCGTTCATT
TCTGCGGCGTGTGAATTTGTCGTGCATGGGCTTGGGAAGAGTCTTCATGGTGTAGAAAGCTTCGTTCGTATCGGGGCAGTACTGTGAGTACGCAGCGAAA
CAGAGTCGCTGACGGCGACTGGTGTGCTTGGCTGCTGACATCGGATTCAGTGATCGCCGAGAGCGAAGAACCACAGATTGTAGTGCAACCCAACCTGGTT
GAGAGAGATCGTTCAAGTCTTCATCTTCCCAGCAAGTGGGGCTGTCGTCTCCGTATTCCATCACCAGAGCAGTCTGTAGATTCTTGTGAAACTCGCGCGA
AACCAACAAGTCTGCGCTCTTGTACTTCCTGGCACCAAAGAGCGAGGCCATACTGGCATCAAACTGCATGGTGTCCCGGCTGAACAGCATCGTCATCGCC
TCATCCAGTCGACAACCTAGCGTGACTTGAGCCGACACGGCGTAGGTGATGCTGTTGTCATTCCGTGGCCACTGCAAAAGTTGTCTCGCCTGTATTTCCG
AGTGAGTATGTTCTCCCATGAAGGCGTCACGAGTGTAGATTGAACCGCGAGACTCGATCATCGAGTGGCGAGAGTCAATGGCTCGTACTGTACCGCGAAA
CCAAGTGGGGCCGTCCATACTTCGTGTAGATGGGAGCTTAGCCCGGTCGAACTCACTGATCTCAGCACCGTGATGCTTCTTCTTGACGACCCAGCACGGC
GGATACTGTCTGTCCGCTGGTGCTATTTGCCAGGCATTACTGCTGCGACTGCATTCTTTGCGGTGCTCTACTACCGCTCGGAGTTTTGGTACGACACTTG
CTGCAGTGGTGAATAGCTCGCGATCGGTCACAAGTGCGTTGATGGACGATGCTGACAGCAATGCGTTGCGTGCTGATACAGGTGAGGCAACGCTGTTGTT
GCTGCTCTGGAAGTCGCAGCTTCGGATACTGCCTCGGCAGCTACTTCCCATGTAGTGACTCTCCATCATTGACGGGTGGTTGGTCTGCAAACTGAGCAGG
TATCGATGAGGTGTTAGGAGCTGGCAAATTGAAGAGTGAAGACGGAGACCACCTAGGGCGATGTTGACGCACAGGTTTGTCAATTGCAATGGTGCTCACC
AATGCACGAAATGGGCTCCATTGCTCCTCGAACTCCGTGTCGGAGTGTCGACGGTACCGGATGCCTGGCGATCTCGCTGGCTTGATGCATCGGCCTGATC
AAGAGTGCAAGTCAGACCTTTTTCGATATTGGTATTGTGGAGTTGGTCCTCACGGACAAGAGTGATACATCATTTCGGTGAACTTTCGATATGTTTGTAA
TGACCACAAACTGCTCGCCAGTCATCACGATGTTGTCCGTCTAGAAGATTCGCAGAGTTTGGTTCAGCAGAGCGTAATGAATATGCTGTCTGTCTTCTTG
GAAGCTGAGGTGGCAGCTTCTGCGTTTCCTTGGTCACTGTCAGTACTAAAGCCCTCGATCCTTACACCACGCGCGTCAATTGTAGCCCCACCAGCGTCTA
CATCAACTGCTTTTCGGTGTCTGATCCATCTTACATTGCCCTTTACAGTCTGGTGTGTTTGATTTTGGTAACGCGCACGCAAGCCCCGTATCTCCTGTCC
AACACGTCTTGCTGCTTGGTGCTCTTTTCGTCAGGAAATTGTCGATCCAGCCGTGTCTGAAAGTGAGCCAGCCATCACGTTGAAGTGACCGGCTAGCCAC
GTAACGGATGACGCGAAGCACACGATCCCAAGTTGGGATACCAAAGCAAAGCAATCAAAAAGCAATGTAAGGAAAAATCACCTTGTACTTAAGAAATAAC
GGAGACAACAAACTTTCCAAATGCATTTCGCGATTCAGGCGTGTTCGTCTACAGCTCGTCGTGCTCGTCGTCGTCGTCCTCATCATCATAGTCATCCTCA
CCCTCCGGGGAAGCACCACCCTGGTAGACCTTAGACATGATGGGGTTGACAAGCTTCTCGACTTCCTTCTGCTTGGCCTCGTAGTCCTCCTTGTCAGCCT
CCTGGTTGTCCTCGAGCCAGTCCATGGCATCCTGGACGGCAGTCAGAACCGTGTCCTTGTCATCCTCGTCGATCTTGTCCTCGAGCTTCTCCTCGACGTT
GTTCTTCAGGCTGTACAGGTAACCCTCGAGAGCGTTACGGCCATCGATACGGTCCTTGACCTTCTTGTCCTCGTCAGCGAACTCCGCGGCCTCCTGGACC
ATGCGGTCAATCTCCTCCTGCGACAGACGGCCCTTCTCGGCAGTGATCGTGATCGTCTCAGCCTTGCCCGTGCCCTTGTCCTCAGCGGACACCTGCAGGA
TACCATTGGCGTCAATCTCGAACGTCACCTCAATCTGAGGCACACCACGCGGGGCAGGCGGAAGACCAGTCAGCTCGAACTTGCCCAGAAGACGGTTGTC
CTTGGTCATGGCACGCTCACCCTCGAACACCTGGATCAGCACAGCAGGCTGGTTGTCCTGGTAGGTAGAGAAGGTCTGCGACTTCTTGGTCGGGATCACA
GTGTTACGGTTGATCAGCTTGGTCATAACGCCACCCACAGTCTCAATACCCTGGGACAGAGGCACGACATCAATCAGAAGCACATCCTTGGTCAGGTCGT
CCTGCTCGCCACCCAGGATACCGCCCTGCACAGCAGCGCCGTAGGCAACAGCCTCATCGGGGTTCACACCGCGCGAAGGTTCCTTGCCGTTGAAGTAGTC
CTTGATCAGCTGCTGCACCTTGGGGATACGGGTGGATCCACCAACCAGCACAATCTCGTCGACCTCCGACTTCTTGAGGTCAGCATCCTTCATCACCTTC
TCGACAGGGCCGAGGGTCTTCTTGAACAGATCCTCGTTAAGCTTCTCGAAACGAGCACGGCTGAGGGACTCCGTGAAGTCCTCACCGTCCAGAAGCGACT
CAATCTCAAGACGAGCCTGAGCCTGAGCCGACAGAGCACGCTTGACACGCTCGGCCTCACGACGGAGCTTTTGAAGAGCACGCTTGTCCGACGCAACGTC
GAGGTTCTTGTCCTTCTTCCACTTCTTGATGAAGTACTGCATGATGCGCTGGTCAAAGTCCTCACCGCCCAAGTGCGTGTCACCATTGGTAGCCAGCACC
TCGAACACACCGCCATCAATGGCCAGTAGCGTCACATCGAAGGTACCGCCACCCAGATCGAACACGAGCACATTCTTCTCGCCCTGTGCCTTCTTGTCAA
TGCCATAAGCAATGGCAGCAGCCGTCGGCTCGTTAATGATACGCTGCACGGTAAGACCGGCAATGGTACCGGCATCCTTGGTAGCCTGACGCTGAGCATC
GTTAAAGTAAGCGGGCACCGTCACAACGGCGTCAAACACCTCGCGGCCGATGTATCCCTCCGAGATTTGCTTCATCTTGGTGAGCACCATGGCCGAGACT
TCCTCAGGAGCGAACTGGCGCTTCTCACCCTTGACTTCCACCTCAATGAAGGGCTTGCCGTCCTTGTTCACGAGGTTGTACGGCAGCAGCTTCTTATCGG
CCTGCACCGACTTGTCATTGTACTTGCGACCAATGAGACGCTTGACATCGAACAGTGTCTTCTCCGGGTTGATCGTAGCCTGGTTCTTGGCACCGTCACC
AATCAGACGCTCGTCGTTCGAGTCCCACGCGACGTACGAGGGCGTGATACGGTTACCCTGGTCGTTGGCAATGATCTCCACCTTCTGGTCCTTGTAGATG
CCTACGCACGAGTAGGTCGTGCCCAGGTCAATGCCGATCACGGGGCCACGCGGCCCCTTAGTTTCGTCAGCCACCACGACGCCGGCGAAGGCCGCCGCCG
CCACGAGGAGGATCTTGGAGAGGTTCATCCTTCTCTGCTTCTCGCTGCTAAAACGATAATGACAAGCTGAGGTGCAACGCGTGGAAGTCAAAGATCGGCG
CTCGAATAGAAGGCACTATACAAATGCCAAGATCAATGTAGTGCTGACGTGGCCGGGCGCGGGTTTCTAGAACCGGGTTTCTCGAAAACCCGTTTAAAAT
TCACTTGGCGGTTGTATGGAACATACTGAAACCAAGTGAACGAATGCCACGCGTCGTTGATGCCCGATTAAGTGCGAAGATATGTTGGCCAGACAACATG
CGGCTGTGCAGTAGTGTTCAATACAAATGAACACGGCGAGAACGCTCATGTGGCAAACTTGTTGGGAGTTGAGCACTCAGTCGCATATTTGCGACGTTGA
GTGAAAATGCTGGCAGCAAAGCTCCAATTGCCACGTAGTGCCTGCAATGAGATCGTACTTAGCTGAGGGCAACTTTCCACGTGGCAAAAGGACAACACCT
CTCGGTGTCATGCACACGGCAGCGATTTGCAATTGCAAACGAGCACGTGGCACCGAAGAAGTAGAATGAGACGGCAAGGACAGGAGCAAATAACTTGCTG
TCTGCAAAGCGCTAGTCGATCCGTAGAATCGTGAAGAAATCTATCTATGCGTCTAGCGCAATCACCTTACGAACAGCAACATTATTGCAATGAAGATGAG
CGATGTACACGATGGCAATAAGGC