Description :
From Genome Similarity Track
Location :
Scaffold_1008:297- 1864
Transcript NameFunction/comments
Phyag_g9093hypothetical protein

Sequence
1567 bases(100 bases per row)
ATTGTGATTCTACCCTCGGTCTCGGGGTACATGATAagtcgcttcttcatcaaatAGTCCGCCACGTGCGTGGTTATCTCGTCTGCAACGCGAGTGATAT
CTCCATTCTGCCAACCTGTGCATCCATCGCCACCGTTTACAATGAACTGCGTTGTTGCGACAGTCACATCATCGTCAGGAAGTAAATCTTCACCACTCTC
GCTTTTGATTGTTGTGATCTGAGGAGGTTGTGTCTTCACATCCACAGTCAATCGCAGACCTGACACGTGAGGAAAAGATCCCGATGGCTGTGGATATTTG
GCCAAATGCTGACTCAACGCAACGCGAAGTTGCTTCACTTGGATCCGGACGAGAACGATTTTTAGCGGAAAAGGCATTTCCTCCTTGGCGATGCCAAGCG
TGATATTCGTGCGTGCATCGTAGACTTTGTTTCCTCGAATAAACCCGCCGTTGATGACTCCAACATCAGCATTGAGTTCTTCACGAAGCGCATCGGCTAC
CAAATTGCCCATGTTGCATTCACCAGTACGTAGCGATGCCGATTTCGAGGACAATGGAAGTCCCAGAATCGCCAATACGCGGTTACTTGCTTCAGTATTC
TCTTGTTCCAGCAGTTGCATGTACTTCGACACGATTCTCTGGCACGCAGGCTGAGCAGGGATGTTCTGGTTGGCGATCATACTCCATTGGGTAGATACGG
TAACTGGCATTGAGGTGTCAATCTTCGATTTGGACAAACCAAACTCGAGCTTGCCGAGCCAGAATGCGTTTTGCCCCGACTTGTGGATCAGAGTGTTGCC
TTCAAAGAGCGTAAAGGGTTCGTGGTCATGGCCACCGACTACAAGGTTAATCGGTTTGACCTGTCGAGCCAATTGCCGGTCTTGCTCGATATTCAAGTGG
GTCAGAGCAACAATGAAATCTGCTCCATCCGCTTGCAACTGGCtgacgcagcgtctcgcaGTCTTGACAACGTCAGCAAACACCACCTCATCGCCGGGAT
TCGAGATCTGCGGTGTCTCCTGGCAGCAAACGCCGAAAAGCCCGAGCTTGAGGCCGTTTTGAAGCTCAATCACCTCAGTATCAACCACGCCGCTGATCGG
TTGACTGGTTTCTCGACCAAGGACATTGGAGCCTAGCCACTTGAACTTTGATTCCCTCATGCGCTCTTGCAGGACTGACACACCGAAGTCGAATTCGTGG
TTGCCCAACACCACATAGTCGATGCCGAGATGGTTCATCAACTCGATCATGTGCGCTCTGCCAAACAGCAAAATGTGTCAAAATACAGACCTTTTATCTA
GGCGACTACGTATTAGTACCCTTTGCATTGCGTTCCGATCTGTGAGCCTGACATGAAGTCTCCATTGAGTGTGACGAGTACTGTCGTGTTGGTAGGAATT
GCAGCTCGTTCGCGATCTAACAGCGTCGCAAATTCAGCGATTCCTACGTAAACCATCAAGTTAGTTAGGCGATTGCATCGTAGTAAGCATTTAGCAAGTA
ACGACGCTAGTATACCTCCACGGCCGTGCTTGTCCGGATACATATCGTAGACGTCGTTGACTGTTAG