Description :
From Genome Similarity Track
Location :
Scaffold_12:297- 1853
Sequence
1556 bases(100 bases per row)
TAGTGAGCCAAGGTAGGCCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACTACCTGAGTTCGTACGTCACCGCACGAACGCAGAGCTAA
GAACCTTCCCATGGATAAGGAGGTGTCCATGAAAAGCTCCACTACGCCTGCAACTCACGTTGCACGGGCTGACTGTCCCCTCTGTCGGACCCAGAGTGGG
AAGCTCTCCAACGACTGTTAACAGTCATTGGTGAGGCGGCTGTAGCTACGATGCTGCGTACGCCAACGCCGACAGAGCAACATGGTGTTGCTCTGGGATT
CATCATGAGGGAGCAGCGAGATGCTGCTTCGTTTACCACGGTGTCGTCGGGGACGGCACCGCGCGCGCAATCGCTGAAGCTCAGCGTGAGCAATTACGTT
GGAAGAGAGGGCGAGCCTCTCCTCCGTTGGCTTGTCGAACTCGACACTGCCATTGCGGCTCGACGCATCGTCGACCCGTTATTGAAAGTCGCGTTCGCCA
GGTCATGTCTTGGCGGACGTGCAAGAAGTTGGGCGTATGAACGCCGACTCTCGGATCCTACGTGCTTTAGCACGTACGAGGGTTTCACGGAAGAGCTCAG
ACAAGCGTTTGAGCCCCCGCAAAACGAGTTCCGGTCGAGGGCGGAGTTCCTCGACCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCA
CGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGGCGACCAAGGTCGTCACGTTCATGAAGGGACTGAGAGATGGGCCTGTGAAGACCTATC
GCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATCACTCTTGCAATGCAGGAGGAGTTAAGCCTGCGGCAGGCTAAGCTGCATGCACATGTGCCGAG
GCCACAGCCACGCCCGGTAGTGAGGACGGGAGGCCCAGAACCCATGGACCTCTCGAGTGCTGCAACTGCCGGGCCCCAGCAGTTGCAGGGAAACAATGTG
CGATGCTACCGTTGCGGTAGAGTCGGTAACTTTGTTCGGGAGTGCACAGCCCTCGTGCACCAGCAGGGTGGCTATCGCGGCGGTGCCGGGCACCGTCGCA
ACCAAACAAAAAACGCTGGACGCCAGTAGGCGCGGGGCGCCCTACTGGTAATGCAGTTCCGCGTGTCGACCTTGGACACGCGACACTGAGGACTGCAGTC
CCCAGTGAGGTTCATTCTCGGTGCAAGAACCAAGATGACAAGCCTGACCTCGTCATCCTGAACGTGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTT
TGGTAGATTCTGGCGCGTCGAAGAACTTTGTTCGACTGCGAAGTCTATCAAGGCTTGACTTCGAGGATTTAAAGATACCTCGAAGTATGTTGGAAGTACG
ACTGGCAACGGGTGCCATCGTAAAGACCCAGAAGCGCATGGTACGCGTGCGCTTCACGTATGAAGATCAAGAGTTTGTCGAGACCTTTATCGTCCTGGAT
CTGGACGATAAGTTTGACATTGTATTGGGCACGCCGTGGCTTGCACGGCAAGATCC