Description :
From Genome Similarity Track
Location :
Scaffold_216:297- 1628
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_216-fgenesh-gene-0.1GTPase

Sequence
1331 bases(100 bases per row)
GACGCTTCGAAAGAACTATCATGTTAAATGCCGATGATTTCCATCTCCACCTACGTGTTACGCAAAGTGGTGTTTCTGTGTTTGAGCGTCCTTCCTCCAT
AACGATTGCTTTCTCGCAGCGAAGAATAAAAGGTGCAAGATGATGAGCGACATCCGGAGAAATGCAACCTCAAAACAGCCCAACTATCTCGTGTTGCACC
CTCTTTCCGCTGATGACGCACACTCCAGCCATTCATTATTGGGTACAAAGACACGCAGTGTTGTCACTCCCGTAGGTCTGTATCGTATCAAGCAGGGTAG
TCAGTCTCTGTTCGCGCATCCCACAAAGCAACCAACCATGCCACCAAAGAAGAAAGAAGAAGTACGTATGCAGTCAGGGCTGCTGCTGGTGACAGATCTG
GCTGACATTATCGTGATGTACAACTGAGCAGGCCCCAAAGCGCGTGTACCTCGGTCGACCAGGCAACAACGTGAAGATCGGCATTGTCGGTGTCCCAAAC
GTCGGCAAGAGTACGTTCTTCAACTGCTTGTCCAAGCTCAACATTCCTGCGGAAAACTTCCCGTTCTGCACGATTGAACCGAATGAGGCCGTCGTGCCAT
TGCCTGACCAGCGTTTCAACTGGCTCGTCAAGCAGTACAACGCCATCAGTGTGTACGTTGTTGCTCCGTAACTTTGCGTTTTGCTTTGCATGCACTGCAG
TTGAGATGTCGCTCACACAGTGCAAGTATACTGATTTGATTGCCGTGCGCGCCATCGCTCGCTGTTTATTTGCTTTGTAAAGTGTGCCTCCAGTGATCGC
CATTACCGATATCGCTGGTCTAGTCAAGGGTGCTGCTGAAGGTGCCGGTCTTGGAAATGCCTTCCTGTCGCACATCCAGGCCGTCGATGCGATTTACCAC
ATGGTGCGCGCGTTTGACTCTCCGGACGTGACCCACGTTGAAGGAAACGTCGATCCCGTGCGCGATATCGAGATCATCCAGCAGGAACTCCGTTTGAAGG
ATATCGACCGTGTCACGAAGCTTGTGGATGGCATGCGCAAGAACGTCGAACGTGGTGTAGGCGGCAAGGAAAAGAAGATGGAGTACGAAGCGCTTGTGCG
TGTGAAGGAGTGGCTTGAAGCGGGCAAGGATGTGTCGTTCGGTCAATGGAGCGCGTTCGAGGTGGATGTGCTGAACCCATTGCAGTTGTTGACTGCCAAG
CCCGTGGTCTTTCTCATTAATGTGAGCAAGAAGGACTACCTTCGTAAGAGCAACAAGTATTTGCCAAAGATCGCTGAGTTCGTGAAGGCTCGTGGTGGCA
ATGAGCCAGTGATTCCTCTCAGTTGCGAGTT