Description :
From Genome Similarity Track
Location :
Scaffold_2057:297- 1623
Transcript NameFunction/comments
Phymu_g13850Eukaryotic/viral aspartic protease, active site

Sequence
1326 bases(100 bases per row)
ACAGCATGTCACGATACTGTGGAGCTACCCTGCGAACGCGTTGCGCGATCGGGCCGGCGCCCCCAACATCAATGTCGCAAACGACTCCTACTGCAGCCGG
TGGCAGAGCGTTCCCTTTCCCGATGAGGAGATGTTTCTTCTGCCAGATGAGATGTCGTAACCGATTGATCATCTGCGGGGTGTTCCACCGGGGGTCACCC
GCTTGGATATCTTCGATCCTGACTTCTTCGGTCGTGTTCACAATCTCAGGCAGGACGGCCATCTGCCCTTCAAGATCCTCCGCGAAAAGACTGCCACCAT
CGTGATAATACCCTTCGGCATCTTCCTGGATCTCAGCAGGTTCTTCCTCGACATTGATCTtcagttcttcttggggttccgctgcgacttcgtcttcgac
cGGAACAGGTGCCTGTTCCTCTTGGTCCAAGGTGAGGCCAGCTACTATGGGTTCGGCCCAACGGACTGTCGCAGCTGCGACAGTCGGTCGGGGGGCAGTT
TCGCCTCTTCGCAAGTTCTCGGTTGGGGGGTCGTATCGCGGATGTTCAACTAGCGGTCAGAACGATTCAGGGGGCGGCTCCTGTTGGTCTTGCCGGTCGG
TAGTCGCTTCAAATGCGAGCGTCTGACACTCTGCATATCTGCGAGATCTGACTGACACGTGACCAGGCACATCCCCAGTTCGGTACTTCGCGACAAACGA
AGTTCCTGATCACCAACGTTGGTGATCCGCAGGAGTCGTCTCCACCCCAGCCCCTTTACAATCGTAGGTATCCATCGTTCTCCACGCACTATCCATAACT
TCTCCCGCTCTAACGCGCGTGGTGGCTTCAGGGGAACGGTACCAGCTCCTGCTACGGGGATTACCAAGtcatcttccagcaacaacgaaTGTCTGCTTCG
GCCGTACGGCGGACGCCGGCCTGACAACTGGATCCTGACCTCGTCCGCCAGACACATCGTCCCGTCGGCCAAGTCCAGGCGGATCCCGGCGGGGACCATG
AAGTCCATGCCCAGAATCGCATCCTGACCCGCCAGGGGACCAACCCAGGCGTCGAAGAAGTATACAAGGTATCTAGCAAGTGTGACCTTGATCGTGGTAC
GTACCAAGGTTGTATACACGTTCTCCCCGATTCCTACGCATTCTTGTCTCTGACTTTCGTCTATGACACAGCCAACCTTACGAGTAAAGGTGGTGTCTAC
AATTGAGACTTCTGCGCCAGAGTCCAGGAGCATCGTGGCCTTCGAGTTGCTGATCTTCCCAGTGATCTTCGCATGCTTGAACCACTTGCCAGGCGAGTAG
TACTTCCAGTACCCTCGCGATTCTCC