Description :
From Genome Similarity Track
Location :
Scaffold_911:2969- 4921
Transcript NameFunction/comments
Phymu_g12331hypothetical protein PHYSODRAFT_341850

Sequence
1952 bases(100 bases per row)
CCTTGGAAACGCTGGTATATACGTACTGGACACGTAGCAAGAAAACCCTCAGTCATATCaaaccagcagctcagaTCAGACTTAATAATTAAAAGTAGTA
CTGATGACCTTACCTTAGTGCTGGATTGCCAGAATGTCAGAACGCGGCCAAGCGACAACGGTCTGTCTCCCTGACCGCTTTGCGCACCACGTTTTCGCTT
CTTGCGACTGACGAGAATTTCGTGGCCGTTGCTGTCGAGGTGCTCGGTGCCCCGGATCGCATGTAAAACATGCCCACAGGACCTAATGCAAACCAGAAGC
TGTAAGCACACCAGATCCTGTCTACATCTATCACCCAACCACCCGATGGCTGGCCTTCCACCTCCATGCGGGCATAGTTTGCCCCCGTTTGGGCAGAAAC
CGGAATGCCCTTCTCCGACTGCTTGTTCAGAGCGACCGAGATGTGGCTTGGGAGTCGCTATTCGACCTGAACGTGTAGGGAGCCTCCAGCACCTACACGA
CCGAACGTTTGCTCGCTGGGCACGGTCAGGTGTTTTCTCTAGATATTTCGAGGGCTGTGTGTGAGGGTTGCCGGCGGAATGACGTCGAACCGGAATGGGC
GGCTCTCGCGACGACTGATCCTCACAGCAGTTCCGTTAGAAGAGTGTCCATCTTCAGATGCCGACGAAGGGTATAGTCACGTTTCAGCAAGGCATTGAAT
GTCTCCACACGATTGCTTGTAGAGGCATACCTGCTCAGCGTTGCGTAGAGTCGACACATGTCATGAACGATTGCACCCGCCACATGCGATGGGAATCCTG
GCATCGCTTGTGGACGTCTTGCATAACGTAGAAAAAACACACTAGGCTTCAGCATTGCCCAGCACATCCAAAAACTTCCAGGAGAGCGATCAATTGGGCC
TGATCAGCGTCTGCTATCGTGTAATAAACCATCCGTTCGTGGGAATGTACCCAAAAGAACAATCTGCGAAGAGCCATCAGTGCAGACTGGATAACGACTT
GCGTCTCCTGAGAGACTATAAAGAGTGCGAGGATGTGGAAGCCGCGTGTGCGGTCTGACACCCCCACGATCAGCGCAGGGTCACCCGCGGAAAGAAGGGG
ACGAAGCCCTGGTCGCAGTCGCCCCCAAGAAACAACCCCGGCAAGTGATCGTCGTGCCCACGCCGATGGTCGAACTGGATGAGGATGGATGGGGAGCTCA
TCGTTGTGAGATTTGACGGGTCTGCTCGTGTGAAGTGCGGCGGCGGAGCATATAGCACTGTTGTCTGGAAGTTGCCCGGATATACGATCCTCCGGGCGGC
GTCTGAGTACGCGACTAGGATGACTGTCAACGATGCCGAGTGCCATGGTTTGCTTATGTACCGGATCTCCTGTCATCTTTCGACAGGGGATGCCTGGTGA
TCTGCGGGGATTCCAACCTGGTGATCCGGCAGATGCGTGGCGAGATCGCATGCAAGGTGCCAGCGTTACAGCTCCTGCGTGAGAAAGCGATGGGCAAACT
CTCGTTATGTCTTCGGCACGAGTTCGTGCATGCGAAGCGGGAATGGAACCAGTGCCGCTCGTCTCACCAGCGTAGCCTTGCAGACAGAAACAGGAACGGT
CGAAACGTCGACGGAGGTCTTCGAAGACTGAGTCACGCTCAATCGACTTAGGGAGATCCTCAAGCCGAAGAGCGAGGAGAGCGTCGTCCGTGTCTCTGCT
GTGACCGATCGTCCTCACGAAGACATGCACCTCCGGAATGCCTCCAAGGAGTAGTGGTGCAGAGCGTGAGGTTAGATCGGGTCATCAGAGCGCAAGGGGA
AGTGAAGTGGATCGCCGATCTGAAGACGTACCTGACAGGGGACATAGTAGATCTGGCGGCAAAGGACACTCGCCGACTCGTACGAGGTAGACAACGACGG
TCTCCTGATGTATTGCCCGATCTCCATGTCTGAGGCTAACGAAATTCGCGAT