Description :
From Genome Similarity Track
Location :
contig_38:296866- 301752
Transcript NameFunction/comments
g8370.t1hypothetical protein

Sequence
4886 bases(100 bases per row)
GGCTCGTTACGCTGCTGTGCCTGTCGCCTTGAGCGTCGATCTTGCTCGTCGACATGGTCCGCCCTCACTGCTGAGCCGAGCGGAGCGCTCAGTCTTTGCG
ATTGCTGACGGACAGCAACAATTTTCAGGTTGTGCTGTTGTGCTGCGACTGTCCACATTGGGTGTGAGCCACAAACCTCTCAATATGATATTATCGACTT
GCGCAGGGGTAGAGTGCGTATCCCACAGCAAAGGACCTTCCTTCTGGGATACTCGACCGAGCGTCATCGAGTCCTTTTACATTTCTCACCGCCGCCGAGC
TTACGGCATTCACCTCCTCGCTGTGCGTCATTGCACCTTTCATCGCGCCGAGCTCAGATACACAGCAACAAACATGCTGTCGACGCTGATGTGGGTCGCG
CTGGCGGTCGCGGTGCTCGTGACCCAGGGCTACATGATCGTGGCGCCTTCCTGCGGCTCTTGCTCCACACGTACTTCCGCAAAATCGTGGTCTACGGACT
CAACAATTTCCCGCGCGAAGGGCCCGTGATCCTGTGCCCGAACCACCCCAATATGCTCGTGGACGCCATCCTCGTTATGACTGAAGTCATTAGCCACGGC
CGTAACCCGTACGTCTGGGCCAAGGGTTCGCTCTTCAGCAACGCCGTCGTCGGGTTCCTCCTCAAGCTCTTCGGTGCTGTGCCAGTGTACCGCCCGCATC
GCAAAGAGGACAGTCTGGCAGATGTGGACTCGAACAAGACACCAGAGGACTGGAGGCCGCTAACCGCGCCATGTTCGAGCATACGTGGCGTGTGCTTGCG
GAGGGTAACGTCATGGTGCTCTTCCCCGAAGGAACGTCCTACACAGCGCCGAAGATGCTGTCGTTGCGCACGGGCGTCGTGCGCGTGGCGACGGGGTTCG
CCAAGCACTACGACCAGCCTATCCCGGTCATTCCTCTCGGGCTCAACTACTTCAACAAGGATCACTTTCGGAGCCAAATGACGCTGGAATTTGGCCCACC
CATGCTGATTACGCCCGACTTGGTGCAAAGCGACGCGTTCCAGGAGGATGAACACAGCGAGGTGAAGCGCTTAACCCATGAGCTGGAGGAGCGAATGCAC
GACGTTACTCTGAATGCGTCTGATTTCAGCACCATCCACGCAGCGCGAATGATGCGACGTCTCTATCTGAACACGCCAGGGTCCATTGATGCCAATAAGG
AGGTTCGCTTGACGCAGTATATTATTAACATGCTGGAGCAAGAGCCTCGCGACGACGAGCAGAAGAAGCGCATCGCAACAATTCAAGAAAAGGTATTGCG
ATACAAGGACGAGCTGGACAGGTTGCGGCTGAAAGACCAAGAGGTGAATTTGCCCGTGCCAAAGGAACAATCGCTCTTGCAGCTGTTCTTGGAGCGAATC
CTCTACCTGCTTGTCTTGCTGCCATTGGCTACACCCGGACTTTTGCTGAATTTCCCATACTATTTTATTGGTAAGTCGGGTTGTTTGCTTTGGGTGACCT
GTGCTGGTAAGATGCTTGAACTGACATCTTCGTTGCTGTGCTGGGAATCAGGAACGAAGATGAACAGTCTCGCGGGATTCGTCGAATCAAAGTCCATGTT
TAAGATCTTCGCTGCAGGGTATGTTAGCTACTTGCCTTTCTAGGTTCATGTTGCTGCACGAATGTTGCTAACATGTCTGTTGTTGTTGTGCGCAGTGTGT
TAGTCCCCGTTCACTGGCTGGTGCTCATTCTTGCAACGTGGTACTTTCTTGGGTCTGCATATGCGTACACGCTTGCCGTGGGGCTCCCACTACTACTTTA
CTCGCACATTCGTGTGCTGGAGGAAAGCCGTTCGATAGCAGAGAATGTGTATTTCCTTTTCAACATCACGGCCCATGCAGACCAGGTCGCAGTGCTTCGT
AAGGAGCGGGAGCTGTTAGCAGAAGAAGTACACGAGCTGGTTACCACGTGCGTGGACGCCAAGTTTCTCTCGGCCGTGCACAAGTCTATCGCAAGCTCTC
CAGGGAAAATCGGCTACGCCACCGCGCCTCCTCCACCAGCGACACCCTGCTTGCAAGATGACGATACCAGAGTGGCTAGAAACGTTTAACGAGTTCGTTG
CGATCTAATGTATCTTTGTGACATTGGTCAATTGTGTTGCGCGGGCCTTCCCACCTTGAACCGAGTGACGCAGAGCCGACAACAGTCGTGACGTAGTGAC
GTCCGGTTTCTCAGGAGCACCCGTGAGCAATGTGATAGCGTGTGAGCCCAGGTGTGCTCGACGGCGGACTCCAAGCGTGCTTGATTCATTCCTGTCTTTA
GCTAATTGCGGAGCTCTAGTCCGACATCATGCCGTTTTTTCTCCTTGTTTTTCAGCTCATCTTCAACATCACAACACAGGTAAGCCACCCGCTGCTGCAG
AAGCAGTAAGCTAACAGCAGCAGCAACGTACGCTTCTTGGTCTTGACAATGTTATCTCGTCTGTCCAGGAAGAACACATTGGCCTTCTTGGTGTAGGTCG
TCTGGTACCCACAAGCACAACGACAATAAAGTTACCCAATCTTCATAAACAACCCCGCCCCATCCAAAACCGCTTTAGAATCGATGTAAACGCACCCTCT
TCGGCTTCACCGCGTCCAGCTCACTCAGCGCGACCTTCAGCTGCTGAATCTGCCATTTTAAATCACGATCCATTGCCGCCAAACTCGTCAGTACAATGCA
CGAGACCAGAAAGTCCACCACTGGTAGCTAGCGCACCTCTCCATCGAGCTTGTGGGCGATCTGCTGTGCTTTCCAGCGGTCGTCGCCGCCGCTCTGCTCC
GTCACCTCTTCAATCTTGGCCATCGCTTTTTCTGAACTTGGCCAAAAATATGTGGACCACAAATGGCTTCTTTTGCAGAGCAATCAGATCAAGGCAATGA
ACGAGGAAGAGGAGTTCGGCATGAGCAAGACGTCGCGGGACGCAGACCCGATGGAGCAGGAGCCCAAGGGCGCCGTGAAAGGCCACCCGGACTTTAACTT
CCTGGATACCGACGAGATCCGCGCGGGCGTGACGTCCGGGGACAAGCGTGCTGTGCCTCTGTGGATGACCAGCATGCCGGTGGAGAAGGATCCGAGCCAA
TGGTCCATTTTGGAGGTGCAAATCCGCCCCGACCGTGCGTGGGAGGTCATGAAGGAGCTCATCGCCACTGTCTGCATCGGCAAAGGTCTCGTTCTGGAAG
AGGAATGCGCTAATTCGGTGCTGTTCCGTAAGAAAGTGACGCAGGAGTCGGTGGCCCACGGTATGGCCAATACTGCCACGTTTCTCAACGTGTTCGTCCG
CATCGGCGTGTCTCCGTCCAAATTACGAGTGGTGGACATCTGCACGCTGGTGTCGAATGAGAACAAGCTGTTGGGCGGCATGATGCCGACGGGGACGAGC
GCTTTCTGGTCGACACAGGACCACAACGAACCGCACAAGTATGCGCTGGACCAACTGTTGGGGGCATTGCAGTCAACACTAATGAGCCAGTGCCTCTCAC
TGAGTTATTTGTACATGTCCACCCCAGAAAACTCCATGGATTCAGGTGCTGTCTACTCGTGCACGGCTGTAGCTCTTTCTGAGTTGATCCTTTTTTCTTG
ACATCACTTTGTGGACTGTTTTCTGGATTGTACAGTTGAGAATGCAGAGCTGGATGAAGGATATGTTGCAGATCTGAAAAGAGCATTCAGCAGGTGGAGT
ACATTGAGGCTATTACTGTTGAAGTGATCGCTGGTAGAATACTAACATGACTGTTTGTTATCTTTTCAGTGAGATGAAAGCAAACATGAGAGACCTGTGC
ATCCCGTTGGAATCGTATGCGTACGACCAGGAATTTGCGTGTGCGTTGCTAATCGGGCTACTGGAACCGACGTTGAAGAAATACGGGATCAACCTAAGTG
ATGTACGTGTAGAGGGTGAGGATCTGGAAAACAACACAGGGGAGACGGTTGCCGATGTTGAAGTTCTTTCGATAAGTAAGGACGGCCCATCATTGACTGA
AGAGAAGGTGCCTTGTCCTCATGAACCGGAGCCTTTGGACGCTACACCAAGAACCGACAAAACTCCGCCAAGTGATGGAGGCAAAATCTATGGAGAAGCA
GTCTCTGAAATGGTGCAAAAACTGTGGAGGGTATGCAAAGAAGATTGCGAGGTGAGAATCCGAGCGAAAATTGATGAGAAGCAACAACAAGTGGCCGCGC
GAGTGGAAGCCGTGCAAAGCTTGCGGACTCGGGTAATTCGGGCTGTTATGGAAGTGTAAGTTTTACTGTTACCATGCTAAATATTTAAACCAAAACTGAC
CCAATGAAATGCTACAGGGATGGTGCTGAAGGTTCGAGTCTCAAATCTTCACCTGCTGGTGACAGGTACGAACGAAATCGACTGCCAAATTGGTCTTTTC
GTTCTCATGGGTGAACTCAAGCAAGTTTGGTCTGTACTTCGCAGAAATAATGTGCTTCTATACGAGGCCTCTTGCATGGTGAATGGCATTCCTGTTACGC
TTCATGTGACTTATGGGTACGGCTTGCACACTGTTCAAATGATGGGTAGTATCCCGATCAAAATTCCGGTGAGCTTACGGCAGGGCTATGTATGATGTTT
TGGTGCTTCGGTATAGCAACGTCATTTATCGGACCATGGTGCCTGTATTTGCGCACACAACGGTAGTTCCGTTTGAAGATGTTGTAAATGTTGTCCAGAC
TACTTCGTTTGGCATTCAGGTGGTTTCTGTGGAGCTGGATTCAGCAAAACATACGAAGGGGGTCACAATTGCGATGGGCCTTGAAGTCGACCTGCTGTAT
CAACTTCTCCATGAGGTGAGCTGACGTATCTGTAAATAATTGATTGATTTCCGCCGCTCGCTCACACTGCGTGTCTTGCAGCTTTT