Description :
From Genome Similarity Track
Location :
contig_38:296824- 301710
Transcript NameFunction/comments
g8752.t1POM68367.1 Acyltransferase [Phytophthora palmivora var. palmivora
g8753.t1hypothetical protein
g8754.t1hypothetical protein

Sequence
4886 bases(100 bases per row)
CGCTACCGCTGACCGTTTCGCAGCAAGTCGCAGGCAACGTGGCTCGTTACGCTGCTGTGCCTGTCGCCTTGAGCGTCGATCTTGCTCGTCGACATGGTCC
GCCCTCACTGCTGAGCCGAGCGGAGCGCTCAGTCTTTGCGATTGCTGACGGACAGCAACAATTTTCAGGTTGTGCTGTTGTGCTGCGACTGTCCACATTG
GGTGTGAGCCACAAACCTCTCAATATGATATTATCGACTTGCGCAGGGGTAGAGTGCGTATCCCACAGCAAAGGACCTTCCTTCTGGGATACTCGACCGA
GCGTCATCGAGTCCTTTTACATTTCTCACCGCCGCCGAGCTTACGGCATTCACCTCCTCGCTGTGCGTCATTGCACCTTTCATCGCGCCGAGCTCAGATA
CACAGCAACAAACATGCTGTCGACGCTGATGTGGGTCGCGCTGGCGGTCGCGGTGCTCGTGACCCAGGGCTACATGATCGTGGCGCCTTCCTGCGGCTCT
TGCTCCACACGTACTTCCGCAAAATCGTGGTCTACGGACTCAACAATTTCCCGCGCGAAGGGCCCGTGATCCTGTGCCCGAACCACCCCAATATGCTCGT
GGACGCCATCCTCGTTATGACTGAAGTCATCAGCCACGGCCGTAACCCGTACGTCTGGGCCAAGGGTTCGCTCTTCAGCAACGCCGTCGTCGGGTTCCTC
CTCAAGCTCTTCGGTGCTGTACCAGTGTACCGCCCGCATCGCAAAGAGGACAGTCTGGCAGATGTGGACTCGAACAAGACGCCAGAGGACTGGAGGCCGC
TAACCGCGCCATGTTCGAGCATACGTGGCGTGTGCTTGCGGAGGGTAACGTCATGGTGCTCTTCCCCGAAGGAACGTCCTACACAGCGCCGAAGATGCTG
TCGTTGCGCACGGGCGTCGTGCGCGTGGCGACGGGGTTCGCCAAGCACTACGACCAGCCTATCCCGGTCATTCCTCTCGGGCTCAACTACTTCAACAAGG
ATCACTTTCGGAGCCAAATGACGCTGGAATTTGGCCCACCCATGCTGATTACGCCCGACTTGGTGCAAAGCGACGCGTTCCAGGAGGATGAACACAGCGA
GGTGAAGCGCTTAACCCATGAGCTGGAGGAGCGAATGCACGACGTTACTCTGAATGCGTCTGATTTCAGCACCATCCACGCAGCGCGAATGATGCGACGT
CTCTATCTGAACACGCCAGGGTCCATTGATGCCAATAAGGAGGTTCGCTTGACGCAGCATATTATTAACATGCTGGAGCAAGAGCCTCGCGACGACGAGC
AGAAGAAGCGCATCGCAACAATTCAAGAAAAGGTATTGCGATACAAGGACGAGCTGGACAGGTTGCGGCTGAAAGACCAAGAGGTGAATTTGCCCGTGCC
AAAGGAACAATCGCTCTTGCAGCTGTTCTTGGAGCGAATCCTCTACCTGCTTGTCTTGCTGCCATTGGCTACACCCGGACTTTTGCTGAATTTCCCATAC
TATTTTATTGGTAAGTCGGGTTGTTTGCTTTGGGTGGCCTGTGCTGGTAAGATGCTTGAACTGACATCTTCGTTGCTGTGCTGGGAATTAGGAACGAAGA
TGAACAGTCTCGCGGGATTCGTCGAATCAAAGTCCATGTTTAAGATCTTCGCTGCAGGGTATGTTAGCTACTTGCCTTTCTAGGTTCATGTTGCTGCACG
AATGTTGCTAACATGTCTGTTGTTGTTGTGCGCAGTGTGTTAGTCCCCGTTCACTGGCTGGTGCTCATTCTTGCAACGTGGTACTTTCTTGGGTCTGCAT
ATGCGTACACGCTTGCCGTGGGGCTCCCACTACTACTTTACTCGCACATTCGTGTGCTGGAGGAAAGCCGTTCGATAGCAGAGAATGTGTATTTCCTTTT
CAACATCACGGCCCATGCAGACCAGGTCGCAGTGCTTCGTAAGGAGCGGGAGCTGTTAGCAGAAGAAGTACACGAGCTGGTTACCACGTGCGTGGACGCC
AAGTTTCTCTCGGCCGTGCACAAGTCTATCGCAAGCTCTCCAGGGAAAATCGGCTACGCCACCGCGCCTCCTCCACCAGCGACACCCTGCTTGCAAGATG
ACGACACCAGAGTGGCTAGAAACGTTTAACGAGTTCGTTGCGATCTAATGTATCTTTGTGACATTGGTCAATTGTGTTGCGCGGGCCTTCCCACCTTGAA
CCGAGTGACGCAGAGCCGACAACAGTCGTGACGTAGTGACGTCCGGTTTCTCAGGAGCACCCGTAAGCAATGTGATAGCGTGTGAGCCCAGGTGTGCTCG
ACGGCGGACTCCAAGCGTGCTTGATTCATTCCTGTCTTTAGCTAATTGCGGAGCTCTAGTCCGACATCATGCCGTTTTTTCTCCTTGTTTTTCAGCTCAT
CTGCAACATCACAACACAGGTAAGCCACCCGCTGCTGCAGAAGCAGTAAGCTAACAGCAGCAGCAACGTACGCTTCTTGGTCTTGACAATGTTATCTCGT
CTGTCCAGGAAGAACACATTGGCCTTCTTGGTGTAGGTCGTCTGGTACCCACAAGCACAACGACAATAAAGTTACCCAATCTTCATAAACAACCCCGCCC
CATCCAAAACCGCTTTAGAATCGATGTAAACGCACCCTCTTCGGCTTCACCGCGTCCAGCTCACTCAGCGCGACCTTCAGCTGCTGAATCTGCCATTTTA
AATCACGATCCATTGCCGCCAAACTTGTCAGTACAATGCACGAGACCAGAATGTCCACCACTGGTAGCTAACGCACCTCTCCATCGAGCTTGTGGGCGAT
CTGCTGTGCTTTCCAGCGGTCGTCGCCGCCGCTCTGCTCCGTCACCTCTTCAATCTTGGCCATCGCTTTTTCTGAACTTGGCCAAAAATATGTGGACCAC
AAATGGCTTCTTTTGCAGAGCAATCAGATCAAGGCAATGAACGAGGAAGAGGAGTTCGGCATGAGCAAGACGTCGCGGGACGCAGACCCGATGGAGCAGG
AGCCCAAGGGCGCCGTGAAAGGCCACCCGGACTTTAACTTCCTGGATACCGACGAGATCCGCGCGGGCGTGACGTCCGGGGACAAGCGTGCTGTGCCTCT
GTGGATGACCAGCATGCCGGTGGAGAAGGATCCGAGCGAATGGTCCATTTTGGAGGTGCAAATCCGCCCCGACCGTGCGTGGGAGGTCATGAAGGAGCTC
ATCGCCACTGTCTGCATCGGCAAAGGTCTCGTTCTGGAAGAGGAATGCGCTAATTCGGTGCTGTTCCGTAAGAAAGTGACGCAGGAGTCGGTGGCCCACG
GTATGGCCAATACTGCCACGTTTCTCAACGTGTTCGTCCGCATCGGCGTGTCTCCGTCCAAATTACGAGTGGTGGACATCTGCACGCTGGTGTCGAATGA
GAACAAGCTGTTGGGCGGCATGATGCCGACGGGGACGAGCGCTTTCTGGTCGACACAGGACCACAACGAACCGCACAAGTATGCGCTGGACCAACTGTTG
GGGGCATTGCAGTCAACACTAATGAGCCAGTGCCTCTCACTGAGTTATTTGTACATGTCCACCCCAGAAAACTCCATGGATTCAGGTGCTGTCTACTCGT
GCACGGCTGTAGCTCTTTCTGAGTTGATCCTTTTTTCTTGACATCACTTTGTGGACTGTTTTCTGGATTGTACAGTTGAGAATGCAGAGCTGGATGAAGG
ATATGTTGCAGATCTGAAAAGAGCATTCAGCAGGTGGAGTACATTGAGGCTATTACTGTTGAAGTGATCGCTGGTAGAATACTAACATGACTGTTTGTTA
TCTTTTCAGTGAGATGAAAGCAAACATGAGAGACCTGTGCATCCCGTTGGAATCGTATGCGTACGACCAGGAATTTGCGTGTGCGTTGCTAATCGGGCTA
CTGGAACCGACGTTGAAGAAATACGGGATCAACCTAAGTGATGTACGTGTAGAGGGTGAGGATCTGGAAAACAACACAGGGGAGACGGTTGCCGATGTTG
AAGTTCTTTCGATAAGTAAGGACGGCCCATCATTGACTGAAGAGAAGGTGCCTTGTCCTCATGAACCGGAGCCTTTGGACGCTACACCAAGAACCGACAA
AACTCCGCCAAGTGATGGAGGCAAAATCTATGGAGAAGCAGTCTCTGAAATGGTGCAAAAACTGTGGAGGGTATGCAAAGAAGATTGCGAGGTGAGAATC
CGAGCGAAAATTGATGAGAAGCAACAACAAGTGGCCGCGCGAGTGGAAGCCGTGCAAAGCTTGCGGACTCGGGTAATTCGGGCTGTTATGGAAGTGTAAG
TTTTACTGTTACCATGCTAAATATTTAAACCAAAACTGACCCAACGAAATGCTACAGGGATGGTGCTGAAGGTTCGAGTCTCAAATCTTCACCTGCTGGT
GACAGGTACGAACGAAATCGATTGCCAAATTGGTCTTTTCGTTCTCATGGGTGAACTCAAGCAAGTTTGGTCTGTACTTCGCAGAAATAATGTGCTTCTA
TACGAGGCCTCTTGCATGGTGAATGGCATTCCTGTTACGCTTCATGTGACTTATGGGTACGGCTTGCACACTGTTCAAATGATGGGTAGTATCCCGATCA
AAATTCCGGTGAGCTTACGGCAGGGCTATGTATGATGTTTTGGTGCTTCGGTATAGCAACGTCATTTATCGGACCATGGTGCCTGTATTTGCGCACACAA
CGGTAGTTCCGTTTGAAGATGTTGTAAATGTTGTCCAGACTACTTCGTTTGGCATTCAGGTGGTTTCTGTGGAGCTGGATTCAGCAAAACATACGAAGGG
GGTCACAATTGCGATGGGCCTTGAAGTCGACCTGCTGTATCAACTTCTCCATGAGGTGAGCTGACGTATCTGTAAATAATTGATTG