Description :
From Genome Similarity Track
Location :
Scaffold_15:296797- 302731
Sequence
5934 bases(100 bases per row)
CCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGACTACCTGAATCCT
CTGTGGTCGCATCGAGTGAGCCAAGATGGATCGTACGGAGTTTCCCCATCTGAGCGACTCGCAGTACGAGTCCGTTCGTAAGATGGCAGGCATCTTTGGG
ACAGATGCCCTGCGTAGCTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTCGACACCTACGAGCGAGGGCTCATCGCCCACGTTC
AAGGGCTGCAGGCCACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTTCACCCCTTCGAAGGGAAGGAAGGAGAAAACCTTCA
CTTCTGGGTTCGAGAGGTTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTGGTCGCGCT
AAGAGTTGGGCGTATACGCGCGAAGCGACGACGCCTGGATGCTTTGCATCATGGTCCCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTCTTCCGGCGAACT
ACGAGTACCGCCAGCGTTCGCGCTTCCACGCCTGCAAACAAGGAAGGCGCGAGCTGCATGAGTACATCCAGGAGATGCGAGTGCTCACTGCCTCTTTGGT
GGGGAACCCCCTGCCTGAACACATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAACTGTTCCGTGTGCAAGCAAACACT
ATGGAGGAGGCGATTCAGATCGCCCTCCAGGAGGAGTACAGTCACAAGCAGGCTCGTACCCCCGCCGCGGTATGGCAGAGCAACCCTGCCTCTGGCGGTG
CGCCTAATGGTAACTCCGGCAATGGAGCGATCAACGGGCCGGTTCCCATGGATCTGGGCATGGCCGAGCAGAGCGACATTCGCTGCTACGGCTGTGGCAA
GCTTGGGCACATGAAACGTGCTTGTCCCGCGGGAAGACTGAAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCGCTGGCAGAAGCCGCGCCCC
AGGAACCAGGAGAACGCCGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACACTAAGTCTTCATGAGGGGCGTGCGGGTGGCGCACGCCATGGGGA
CTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCCGGATACGATCATCCCTTGAGA
ATCTTGATCGACTCTGGGGCGTCCAAGAACTTTGCGCGCCGCCAGATTGTCGCACGCAATCGCGACAAGTACGCCGATGTGCTACGAGGCAGCAAAGGCA
ACGGGCTGGTCTCGGTATGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGTCCACATGGACCTCACTGTCAAGTTCGAGGACTTCGACAGCACGGA
GCCGTTCTTGGTCCTAGACATGGACAAGTACGACTTGATCCTTGGCATGCCGTGGCTGGAGAAACACGAGCCTTGGATCGACTGGCGCGGCAAGGCCATC
GGGGCCAGCCGTCCCCCACGCTCTGACAGAGCTTTGGTGAGTCATGTTCCCACCTCTGGCAGCAGCTGGGGCGCCCGCGAGGGCCACCAGGGCGCAGCAG
CGTCTAATGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTCTGACCGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACCTACCAGGTGGG
TAACGTAGGTCCACACGCGGGTAACGAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAGGCGCCGCTGGCGTTGGCGTGGATAACCAAGTTCCACGCGAG
GTCACTCAGACCGTAACTGATGAGGAAGGCACTGCAGGCGCTTCCGATGTGGGTAACATAGTTCCACAGGAGGTCACTCAGACCATAACTGATGCGAGTC
GCTGGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGTGTAACATAGTTCCACCCAGCAAGGCGGGTAACCAAGTTCCGCTCAAGAACA
AGGCGGGTAACCAAGTTCCGCTCAAGGACAAGGCGGGTAACGTAGTTCCGCACGAGATCGCGAAGATCGGTGGTGCCGTCAAGGCGGCGCCACGAGACGA
AGACACCTGATGGTCACGTCGTAAGCCGGGCCTAGTCGTGTGGCCGACGACGCCAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCGAA
GAGTGTTATCACATCTTCGACGGCGTGACCGGTCGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGTTGCTGAACCTTG
AGGAGCTCGCCATGGAGGACTTCTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACGTCGGCCGAGTTGAACTC
GTCCTCGGTCATGGAACAGGCAGTCCTGGAGGAGTTCCAGAGACAGCGCGCGTCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCGGGACCCGGTGTAC
CCCTTGGTGAAGGAGTTTGAGGACGTGCCTGGTGGACGGATACTACCAGGTCCTGATGCGCGAGAGCGACATCCCACTCACGGCTGTGAGCACGCCCAGC
GGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATCGCTTGGTCACACAACTGTTCCGACCTTTGCGTGCGT
TCACACAGACGTACTTTGACGACATCTTCGTCCACAGCCGTGCCGAGGCAGGCCAGAAGGCCATGGAGATGCATCTCCAGCACCTTCGACGTGTGTTCGA
AGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTCGCAGCTGAGGAGATCAAGGTCCTGGGCTGCTTCGTCAGCAGCGCCGGGGTC
CGGGCGGACCCGGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCACCTCGGTCGCAGAAGGACCTACGACAGTGGTTGGGCCTCGCCAACTAATAGTGTA
GGCTACGCCGAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATGTCGACTGGCACTGGGAGCGTCGCCATCAAGATGCTTTTAACGACATCAAAG
CGAGCTTAGTGTCCAAGGATCCACCGTCCAATCTCCCTCTGGACAGGGGAATCAGGCACGAGATCAATCTCGTGCCGGGCACGAAGTACTGTGTCACGAG
GCAATGGCCTCTTCCCCGGGAGCAGTGTGAAGTCGTTGATGCCTTCTTTGCCGCCAAGGCGAAGGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCG
ACGCCTACCTTCTGTGTTCGCAAACCGAACGGAAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCGACAGTGCCTGCGCAGACACCGATCC
CGCGCAAGGACGTGTTGCTCAACAACATGGCCGGCTGCACGCTGTATAGCGCGCTGGACGCCAGTCCTGGCATTGCCGGGCGAGACGAAGTCTTTCAGCG
TAGTCTGTGATGCGTCTGACTACGCAATTGACTGTGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGTCATCTCGTTCCAGTCCAGGCAGCTCAA
GGCAGCCGAACGGAATTATCCAGTCCACGACAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGAGTGCACCTCCTGGGCTCGACGCCCTTT
GTCGTTTATACAGACCACGCGTCCTTGCGGACTGCCGTCAACACGCCGCATCTCTCACAGCAGATGGCGCGTTGGCTGTCATTCTTCGCGGAATACAACT
TCCGTGTCGAGTACAAGCCGGGCAAGTTGAACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATTAGTCGGGTCACGACGGA
TCTGTATGATCGCATCAGGCTGGGGTACCGAGACGATGCCAGTCTCGGACCTCTTGTGCGGTTCTTGGCCGCTGGCTCGGAAGCCAAGGCCGAGTGGCTC
ACGCCCCGACAACGTGCAAGGCTGCACCGCTATGAGTGGGCTGACGGTTTGCTCCACTATAGGGTCGAGCCCGAGGATCCTCCCCGTATTGTCGTGCCCA
ACGACGAGGATCTCAAGTACGACATCCTGATGGAGGCGCACGACGTTCCATCCAGTGGCCATCTCGGCCGTGAGAAGACGTACGCGTCTGTCTTGCAGAT
GTTTTGGTGGCGTCATATGTACAAGTGGGTCGCCACCTACGTCCGTACGTGTGAGACGTGCCAGCGCGTGAAGCCGCCGGTCACGCCTCGGCACCATTGC
AGAGCCTGCCGGTCCCAGCGGACTGCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGGACTTCCGGCCGATGACCGTGGCAACACTGGTGTTGTTGCCTT
CGTGTGCCGTCTGAGCAAGATGGTCCACATTGCTCCAGTTCGTGACACCGTCACTGGCGACGAGGTCGCTCGCCTGTTCATGGACTGTGTCTTCCGACAC
CACAGTCTGCCCGAGACCATTGTCTCTGATCGAGACCCAAGGTTCGCAGCTACGTTCTGGCTGACGCTGTTTCGCCTTCTCGGCACACGACTGTCGATGT
CGACGGCGGACCGCCCGTAGACGGATGGCCAAACGGAGCGCGTCAAACGCGTGCTCGAAGACACGCTCCGCAGTATCTGCGCGGAGATGCCCCGCTCTTG
GGCTGATCGCTTGCCCATGGTTGAGTTCGCACTCAATAATGCGGTACATGCATCGACGGGCTTTACGCCCTTTTACCTGAACGGATTGCGCCACCCTCAG
GTGCCGCTCACATTACGAGGCAGTACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGTCCAGCCA
CCTTGTGGAAGCAACTGTCCTCGTTTGCCGAAGACAGGCTGAACATACTCAGCAGGGTGCGAGACACCATGGCGCAAGCCCAAGATAAACAGAAGGAGTA
TTCTGACCGAAATGGAAGAGGAAACATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAGAAACCTACCGCTAAACACTGTTAGCTCGGTC
GAGAGCAACAAGCTGAAGCACCGCTTCATTGGACCCTTCACGGTCCTCAGCCGGCATGGCGCGGCGTACACCATATACTTGCCCAAGTCGATGACGACTC
ATCCGACGTTTTACGTGGGTCGTCTTAAGAGGTACCATGACCCTCTGGCTCTGGCTGCCCCGCCGGAAGCGGTGGGTGGCCCGGTGGAGAAGAGCGCAGC
TCCTCGAAGCGCGGCGTCGAGTCGCGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGTACATCGGAGCAGCATACGCAGGGGCCCCGTACGAGCCCTGG
CCAAACTGGGCCTGATACGAGTGGGGCTGCTGCTGCTCCGGATACGGCGCGGGGCCATGAAGCTCGGCCCGAAGGCCAGCGAGCTGGTTTCACAGCGAGT
CGTAAGACGACAGGTCGGCTCGACGATCCACACGGCCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATCCTCACGGAGCCGCTCCACGGCACC
AGGCTGACCAGCACGAGCGGCAGCCTCGCCACCAAGGCCGACGCCAAGCGCGATCTCGAGGACGTACACACGGTCCCGGAGAAGACGAATCTCCTCTTGC
TGCAAGGCCACCACCTGACTCGGAGCCCCAGCATACGGCTGCGTCGCCTCAGGCTCGTAGCCATGGCCGTGCGAGGCCACCGCCGGTCCTCCTTGATCGT
AATGAGTTGAGCGAACTCGATGCGGAGCTCGCGC