Description :
From Genome Similarity Track
Location :
Scaffold_100:29665- 34534
Sequence
4869 bases(100 bases per row)
GAAGGTGTGGTTTGCTTTCGTCCATAATGGTGCGTACAAAACCAAAAGTACAAAGGTTCGCCAAAACAAACCCGGCAAATGATGTACCCATGGTAAGTGG
CCATTCAGCTCCTACTTAAGCAATATAATCCACAAGTGCGGGGAGCGAGTATGTCGTCGCAAATCATAGCCATAGGGAAGGCCTAGAATCTTCCAGCAAT
CCAAGAATCCAGGTAAATGCTAAAGCAGAAGATTCTGGACATGACGAAAGGTGGGAAACCTCCTCGTTTGTTTTGAGTATTATGAGGTGGTCTGATCCAA
CTTTGCATGCCAGGTAAGACATTACAATGTATTAAAAGGTCCAGAGCAAAATTTATTTTTGTACTTAGCCCTATAGAAGCTCTGCTTGAAACACTGGAGG
AGAGTACTGTTTGGCGCGAGTTATATTGGAAGCCTTCATCGATTCAATGTGCGCGGTGTATACATGTATCGATTCTTCACATGGGACAGTCATCTAATTG
GGTCATAAGTTATTATACAATTTTCGCTAACCAAATTTGAAGGAATGTGGCAATACTAGAAGGTGATATTTGAGATTATATAGATGTGTGGATGTACCCA
AAGTGATTTTTGGCTCTACCTGTTCCCAGACTATCTTAATACCTTATTAAAAAGAAGACAAAAGTAATCGAGCTTTTTTATTGCCCTTGATTACGATCAG
AGGATTATAGATGATTACAAGGAATAAGTATGGAATTCGGTTAAGTCCCTCAGCGATTGAGATTCTTAAACACCTTCTCCAATCTCCAAACAAGATGATT
TGACAGCATGAGTCATGAGCAACCTCCTACGAAAATGCTCATCATATATACATCGGGATTGCTGGGGTTGGCCTTTAGGTACGCGACGATATACGGTAAG
GTCGTCGTGATGTACATATATAACTTCTGACGAAAAATTGTGCTTAAGAGAGCTTACCAAGCTCAACAACGCGGTGGATTAGGTCTGGTAAATATCAATA
TGTATAGGACAATAATTTTAATAATTTGAAAAGTGCTATTCATGCGTCGTTTTTGCTGTGTGTAATATCGATAGACAATTATGGGTGAGAATCATAAGAA
ATATATGACTTGAAGCGTGTGATGTTGGTGACTGTGTCTTTTGCGGGTCAAATTATGCGTCATTGGGGGTAAAAGAAGAGAGATTTTCACGCTGAAGAGT
CTACAACAATAGCTGCTAGTTGACAATGACACTAACAATGTGACGCATTAATCACATGTGCGATTTTTTCCTTTTAATTATATATATTATTCATTCGGTA
AGGACTGATCGCTATACTAACGGAACCGCAATAACTATCACATATCAGGAAATCAATCATATTTCTACTGAAGTCAAACAACTAAATTTATATCAAGTGA
AAACTTACTTCTGCTGTTGCCGTTAATCCTCACGTACCTGCAATTTTTGAATTCAAGGAAGAGGCGTGTATTGTGACTCGTCTCTCGGTATAACGACACC
ATAAGCGTAGCACGGGAAAATCTCAAATTGGTAATAATCAACAGCTTTTATGCTTATACCTTCCTGATCTCTTACCCTATTTTTTACAACCACAACGTAT
CCTTTGTTGTGCATAGGCACCAACAGCTATCTTTGCTTGGTCAAACGAAGCTTACACAATCTGAGGCAGTGTTGCCAATTTTCTTATTAATGTGCGAATA
ATACAAAAGGAAATCCCCCAATCACCTCTACCTTGTTGTTTCGTCGCCGGTAATATTACTTAATTAGAGCACAATAATCTAAATACGACCAAAAAGGAAA
TCGATCGATCAGCACTATCCCAAACAGACTTGACTGCGACAAATATCAGTTTCATTTGACAGATTCACACTAACTAAAAGCGCTTTATCTTTCTTCTAAA
CGCAGAATGAACAGATGAAAAGCCGAAAATACATGTTAAAAATGAGAAGACACGCCATTCTTGCTGACGTCTGCGGCCGGGAGGGTGGATGCGGAGATTG
AGAGTAATTCGAATGCTATGAAAATTCGAACGAACGGCATTTAGGGAGCAGTAGAAATACGTGATAAACCTCCAGATCCTACAGTAACGCAAAATTGCCA
TTAATGGCCATGTATGATGCGCCTCGTGAGAAGGAGATACGAAAGCGATAAAATGCAAGACTGAGGCTCTAAAACAGAAAAAGCGCACCACTCTGTTTAT
GGTATCAACTAGACTTTTCTTAGAACTAGGGGCAAAGCCTGCATTTATGTATTTGCAGGACTTTTATTTGACAACGTTAATGACTACCAATATCGTTAGA
GAAGGACAAAATCGTCTGAGCATAGGGTAACTGCTTCCTGCGAAAACATAACTAGTCTTTAGTCAAATAAAACCTAAGTTATAGACGTACACAATACAAA
AAAATGACTATATATAGAAGCGAAAAGATGGTCGTGGTTTGAGAGATTCCTGCTGGGGTTACATTAGGTGACGCGCAAGTGGACAATCGAGTCTACGATC
GAGATCCAGATTGGCAAATTTATCCATTCACAGCTACCTTATAATAATATCGGAAAGCTCACATTGTCATGACGTATCGTTTGGAATTTGATGTCAAGGT
CGGAGCACGCTCGTCACAGTGTGTAAGAACTTCAATCAGCTCCCTGCTGGAGCTTAAGCCAGTTCTTGTACATTTCAAACCTAGAGATGAAAATGAATAC
TGAATACACCGAATCGTTAGCTACTATCCCTAAGTCGCCTAACTGTCATTAACGGTCTCAAACCTTTCCCATTCAACTTTCCCATTTATAGGACCTTTCC
CACATTGCAGCTCTCAGCTCTCTTTTCTTCTCTTCCCAAATTACTGTTGTTCAAGTGTTCGTTCTCCCTTCTTGAAGTTTTCTCTTCGATTATCAGCATC
TCCAAGACCGAGTACATACAACAGTCGCTTCAATATCTTCTTTTCTAAAGCTTTAGTAAACACATCTGCGGAATTATGCCCTGCCTTCGCCTTGCTGTAA
TGGCTCCTTTCTCGACTTGTTTGCGCACATAGTGCCATCTTAGTTCTATGCGCCTTGTTCTCCGAATGTATGTGGGATTTATAGCCATTACATAAGCCAC
TTGACTGTCAATACCGATGCGTTATGATAACTACTTCTGTGGCAGTATATCTTGCAGAATATTTCTCATCGCAAGTGCCACCATGGATGCTTCACACGCA
AGTGCCACACTCTCAGCTCAGCGATTGACAGTGCAGTGATTTTGTGCCGGCGTGACGTCCACGCGATAGCGCCATTCAATAATATACATACAAATCATGT
AGTGATTTTCCTCTCCTCCAGATCATTGGCCCAGTTGCTATAACACAATCTCTTCGCAATAATATCGCCTTTTGGCTGCTGCTTCTTTCACATGTAGGTG
ATTCTGTAATCTGGCGCGCCAACTGAGTAGTGCAGAACTCGTTTTCACGGCCCTAATATGCTTGGACGCATGACAAAGCGAATTAATTAACCTAAGGCGA
ATGCCGAAACAGGTCTCTTCCTGGTGGCCAGGTACATGGGCATCCCGACTGCCCCTCGGTACAGAAATTTCACATTTATGTACTCATTTTCACTAGCTGG
GTTGAGATGAATATTCACTCTTATGGGGTTTACCACAGCATGAGCGTCCACCTATTTACATAATGCTTAAATTTCGCGTGTATATTTGCATTGCTCAACA
GAGAATCTGCTCCGGATTCTGCTCGATCTAGTGCTAAGGTAGTCTGTGAGTAAACCCTGATCTACTATTCCATACGCATCGTTCAAATCCATGACAAACA
TGCTCTTGCACTGTTCCTTATTCTTTGCGACGAATAGGTCATCGACGTAGACGAGTACATTCAGGAGTGTCTCACCCTTTAAACGATAGTATAGACAAGT
TTCCACCAAGAATTGCTGGAATGCATGACCTCGCAACCACAGATTTATCTCGGAGTTCCAATCTCGCCCAGACTGTCGCAGTCCATATAGTGCTTCAAAA
ATAACGGATATGTATTCATCGTTGGTGCACGGGTGCCCATCAATTGATTGTAAGTACTGTCGAATCCCAAGCGGAGCATTTTAATATGCAGTGGAATTAT
GACATTCGTGCCACTGGTGCAAACGTTTCTATAATGTCAATACCGGCTCTTTGACAGTTTCCCATCGCTGCAATTTGTCCTTTTAATCTGATCACATAGC
GCATTCGATCATACTTGATAACATAGACTCGCATTGTTTTGACTGAATGAGCGTTCGTGAACCTTCTTCTCTTAGAGTTTCTTTAAGAAGCCTTTTTCTC
TGACAGCTGCCATCTCGGTAATTTCGGCCGCTTTGAAGAATTGCTTTCTTGACATATTAAGCTTAAATCATGATAATGAGAAAACAGTAGATGATCGTCG
GTCATCTAAATATATGAGGTGATTAACGTACCATTTAGCTTAACCCAACATTTAATTTTTGAGTATGAGCATACAGCTAACTGTTGAGACAGTTACCGTT
GCTCAGCAGTGTCGTCGCGCTGGAAACAAAGAGCAAACGTACATTAATGGATGAGTCATTCGAAGAAGATAAAACCGATGGAAACTGTATCATCATCGAA
AAAGGATGCTTATTAGTGGCTTGAGTGGTAGAAGGGGACAAAAAGAAACGATTTAATGATAGATAAATGAAAAAACTGATATTGTCGTAGTCGTGTCTAT
TTTTTACGCAGCGGCGTCCGAGTGATTAACTTGTTGGTCTAATTATGCATTATTGGGTCCCAATTAGATAATAAGCCGGTGGCGAAACAACAAGTTACGG
TGATCGAGTTGTTGTCGATAAAAGTTTAGCTTAATTATAAATGCAGTATCACATTTACCAACAGCAGTG