Description :
From Genome Similarity Track
Location :
Scaffold_291:2966- 4836
Transcript NameFunction/comments
Pytve_DAOMBR484snap_masked-pve_contig_291-abinit-gene-0.25Myosin

Sequence
1870 bases(100 bases per row)
CTGCCGCCACACGTGTTCGCGATCGCGGGCAAGGCGTTCGCGGGGCTGCTCAAGTCGACGCGGCGCAACCAGTCGATCCTCGTGAGCGGCGAGAGCGGGT
CGGGCAAGACCGAGTCGACCAAGTTCCTCATGCGGTTCCTGACATCGGTGGGCCGCGACCAGTCGGCCTCCAAGGACCTCGAGGGTGATGTGGTCGAGAT
CGGCAAGCGCATCCTGCAGACCAACCCGATCCTCGAGTCGTTCGGCAACGCGCAGACGATCCGCAACGACAACTCGAGTCGCTTCGGCAAGTTCATCAAG
ATCCAGTTCGGCGAGCGGAGTGAAATCGTCGGCGCCGAGATCGTGTCGTACCTGCTGGAGAAGGTGCGCCTGATCCACCAGTCTCCGGGCGAGCGCAGCT
TCCACATCTTCTACGAGCTGCTGGAAGGCGCCGGCGCCGAGACGCTCGAGCAGCTCGGACTCCAGCAGGGCGGCAAGTACGAGCTGCTCAACTCGTACGG
TCCGGCGTTCGGTCGACGAGGAGGACTTGGCGCCAAGTACAAGGCGCTGTTCGACGAGACTGTGCGCGCGTTCGAAGATACGGGCGTCCACGAGGACGAG
CGGCTCAACATTTTCAAGATCCTGGCCGCGCTGCTGCATCTGGGCAACCTCAATTTCTCGGTCTCGACTGCTGGACGGGAGGAAGTCGTCGCGATCGACC
CGACGACGCTCGTGAATCTGGAGAAAGCGGCCGAGTTGATGGGTCTCAACGCTGACAAGCTCAAGTCCATCCTGCTGAGTCGTGTGATCACGGCAGGATC
CGAAGTGATGGTGCTCAAGCTGACAGCGGAGCAAGCCAAGGATGTGTGTCGATCGCTGGCGAAGGCCATCTACGGTCGGCTGTTCACGTGGCTTGTGCGG
CGTCTCAGTGACGAGATTAATTACTGTGATTCGACCATGGGCGACTCGGATGATGACGTGGCGACGATCGGCATTTTGGACATCTTCGGCTTCGAGAGCC
TCGAGCAGAACGGGTTCGAGCAGCTCTGCATCAACTACGCGAACGAGCGGCTCCAAGAACAGTTCAACGAGTTCGTGTTCATCAAGGAGCAGCAAGTGTA
CATCGCCGAGGGGATCGACTGGACGTCCGTGTCGTACCCGAGCAACGCTGCGTGCTTGTCTCTGTTCGACGACAAGGGTAACGGTCTCTTTTCGCTTCTG
GACCAGGAGTGCTTGATGCCGAAGGGCTCCGACCAGGCTCTCAGCACCAAGTATTACCGATACCACGGCACCTCGGAAGATGTGGCGACGCAAGCACACC
AAGCGACGCAGAAGTACACGCTGCCGCAGTTCGTGAGCTCGTTCGGTCGCTTGTTGCGCAGCACGTCGTCTCAGGAGATTGAGGACGATGAGCCGACTGT
GGACACGAGGAAGCACCCGTTCTCAGCATCCAAGATGGAGCGCGTCAACCACCAGTTCGCTATCCACCATTTCGCCGGCAAGGTGCGCTACGGTGTGCAG
CAGTTTGTGGAGAAGAACCAGGACACACTGCCGACGGACGCGAGCACCATCTTCAGTGGCTCGTCGAATCCTGTCGTCGTGTCTATCGGAGATACTTTGC
TCGTGGACCAAGACGCTGAGAACGTTCCCGGTCGGCGGCGGTATTCCATGTTGCGGTCTCCGAGTGTGTCTTCGCAATTTCGAAACCAGCTGGATCGCTT
GATGACGCAGATCGGCAAGACGGAGCCGCACTACATTCGGTGTCTGAAGCCGAATGAGCTCAAGAAGCCTGGCGTGTTTGATCGAGAGCGGATGGTTGAG
CAGCTGCGGTCTGTTGGCGTTTTGGAGGCACTTCGCATAGCCCGTGCTGGGTACTCTGTGCGCCTTGCTC