Description :
From Genome Similarity Track
Location :
Scaffold_15:296549- 301912
Transcript NameFunction/comments
Physo_131299pol protein
Physo_131300hypothetical protein

Sequence
5363 bases(100 bases per row)
GTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAGGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGACTGTTCACTTGGAGTT
TGTATACTCCTGCTTCCTCTGTTATGAAGTGCTGTGCGACCCGTCACACTTGGTAGCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGACTACC
TGAATCCTCTGTGGTCTCATCGAGTGAGCCAAGATGGATCGTACGGAGTTTCCCCATCTGAACGACTCGCAGTACGAGTCCGTTCGTAAGATGGCAGGTA
TCTTTGGGACAGATGCCTGCGTAGCTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGCATCAACGCGTTCGACACCTACGAGCGAGGGCTCATCGCC
CACGTTCAAGGGCTGCAGGCCACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTTCACCCCTTCGAAGGGAAGGAAGGAGAAA
ACCTTCACTTCTGGGTTCGAGAGGTCGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTGG
TCGCGCTAAGAGTTGGGCGTATACGCGCGAAGCGACGACGCCTGGGTGCTTCGCATCATGGTCCCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTCTTCCG
GCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGCGCGAGCTGCATGAGTACATCCAGGAGATGCGAGTGCTCACTGCCT
CTTTGGTGGGGAACCCCCTGCCTGAACACATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAACTGTTCCGTGTGCAAGC
AAACACTATGGAGGAGGCGATTCAGATCGCCCTCCAGGAGGAGTACAGCCACAAGCAGGCTCGTACCCCTGTCACGGTATGGCAGAGCAACCCTGCCTCT
GGCGGTGCGCCTAATGGTAACTCCGGCAATGGAGCGATCAACGGGCCGGTTCCCATGGATCTGGGCATGGCCGAGCAGAGCGACATTCGCTGCTACGGCT
GTGGCAAGCTTGGGCACACGAAACGTGCTTGTCCCGCGGGAGGACTGAAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCGCTGGCAGAAGCC
GCGCCCCAGGAACCAGGTGAACGCTGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACACTAAGTCTTCATGAGGGGCGTGCGGGTGGCGCACTTA
GCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCGGGATACGATCATCCCTTGAGAATCT
TGATCGACTCTGGGGCGTCCAAGAACTTTGCGCGCCGCCAGACTGTCGCACGCAATCGCGACAAGTACGCCGATGCGCTACGAGGCAGCAAAGACAACGG
GCTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCACGGGTCCACATGGACCTCACTGTCAAGTTCGAGGACTTCGACAGCACGGAGCCG
TTCTTGGTCCTAGACATGGACAAGTACGACTTGAACCTTGGCATGCCGTGGCTGGAGAAACACGAGCCTTGGATCGACTGGCGCGGCAAGGCCATCGGGG
TCAGCCGTCCCCCACGCTCTGACAGAGCTTTGGTGAGGTATGTTCCCACCTCTGGCAGCAGCTGGGGCGCCCGCGAGGGCCGCCAGGGCGCAGCAGCGTC
TAATGAGTTCTTGGGGTCCGTCAAGACTGACGGCGACTCCGACCGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACCTACCAGGTGGGTAAC
GTAGGTCCACACGCGGGTAACGAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAGGCCCCGCTGGCGTTGGCGTGGGTAACCAAGTTCCACGCGAGGTCA
CTCAGACCGTAACTGATGAGGAAGGCACTGCAGGCGCTTCCGATGTGGGTAACATAGTTCCACAGGAGGTCACTCAGACCATAACTGATGCGGGAGTCGC
TGGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGGGTAACATAGTTCCATCCAGCAAGGCGGGTAACCAAGTTCCGCTCAAGAACAAG
GCGGGTAACGTAGTTCCGCACGAGATCGAGAAGATCGGTGGTGCCGTCAAGGCGGCGCCACGAGACGAAGACACGTCGTAAGCCGGGCCTAGTCGTGTGG
CCGACGACGCCAGTCGCCAGCGACTCCGAGCCTCAAGCCAAGGCTCCAGCCACCGAAGAGTGTTATCACATCTTCGACGGCGCGACCGGTCGTCGGGTCA
AGACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGTTGCTGAACCTTGAGGAGCCCGCCATGGAGGACTTCTTGGCCGAGCTAAAGGCCGG
GGAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACGTCGGCCGAGTTGAACTCGTCCTCGGTCACGGACCAGGCAGTCCTGGAGGAGTTCCAGAGA
CAGCGCGCGTCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCGGGACCCGGTGTACCCCTTGGTGAAGGAGTTCGAGGACGTGGTGTCCAAGGATCCAC
CGTCCAATCTCCCTCCGGACAGGGGAATCAGGCATGAGATCGATCTCGTGCCGGGCACGAAGTACTGTGTCACGAGGCAATGGCCTCTTCCGCGGGAGCA
GTGTGAAGTCATTGATGCCTTCTTTGCCTCCAAGGCAAAGGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCAAA
CCGAACGGAAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCGACAGTGCCTGCGCAGACACCGATCCCGCGCAAGGACGTGTTGCTCAACA
ACATGGCCGGCTGCACGCTGTATAGCGCGCTGGACCTGGTGGACGGATACTACCAGATCCTGGTGCGCGAGAGCGACATCCCACTCACGGCTGTGAGCAC
GCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATCGCTTGGTCACACAACTGTTCCGACCTTTG
CGTGCGTTCACACAGACGTACTTTGACGACATCTTCGTCCAAAGCCGTGCCGAGGCAGGCCAGACGGCCATGGAGGTGCATCTCCAGCACCTTCGACGTG
TGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTCGCAGCTGAGGAGATCAAGGTCCTGGGCTGCTTCGTCAGTAGCGC
CGGGGTCCGGGCGGACCCGGAGAAGGTGAAAACAATCGCGGCTTGGCCGCCACCTCGGTCGCAGAAGGACCTACGACAGTGGTTGGGCCTCGCCAACTAC
CTGCACAAGTATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTGTTGGATCTCCTGAAGAAGGATGTCGACTGGCGCTGGGAGCGTCGCCATCAAGATG
CTTTTAACGACATCAAAGCGAGCTTACAGCGCGCGCCAGTCCTGGCATTGCCGGACGAGACGAAGCCTTTCAGCGTAGTCTGTGATGCGTCTGACTACGC
AATTGGCTGTGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGTCATCTCGTTCCAGTCCAGGCAGCTCAAGGCAGCCGAACGGAACTATCCAGTC
CACGACAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGAGTGCACCTCCTGGGCTCGACGCCCTTTGTCGTTTATACAGACCACGCGTCCT
TGCGGACTGCCGTCAACACGCCGCATCTCTCACAGCGGATGGCGCGTTGGCTGTCATTCTTCGCGGAATACAACTTCCGTGTCGAGTACAAGCCGGGCAA
GTTGAACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATTAGTCGGGTCACGACGGATCTGTATGATCGCATCTGGCTGGGG
TACCGAGACGATGCCAGTCTCGGACCTCTTGTGCGGTTCTTGGCCGCTGGCTCGGAAGCCAAGGCCGAGTGGCTCACGCCCCGACAACGTGCAAGGCTGC
ACCGCTATGAGTGGGCTGACGGTTTGCTCCACTATAGGGTCGAGCCCGAAGATCCTCCCCGTATTGTCGTGCCCAACGACGAGGATCTCCAGTACGACAT
CCTGATGGAGGCGCACGACGCTCCATCCAGTGGCCATCTCGGCCGTGAGAAGACGTACGCGTCTGTCTCGCAGATGTTTTGGTGGCGTGACATGTACAAG
TGGGTCGCCACCTACGTCCGTACGTGCGAGACGTGCCAGCGCGTGAAGCCTGCCGGTCACGCCTCCGCACCATTGCAGAGCCTGCCGGTCCCAGCGGACT
GCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGGACTTCCGGCCGATGACCGTGGCAACACTGGTGTTGTTGCCTTCGTGTGCCGTCTGAGCAAGATGGT
CCACTTTGCTCCAGTTCGTGACACCGTCACTGGCGACGAGGTCGCTCGCCTGTTCATGGACTGTGTCTTCCGACACCACGGTCTGCCCGAGACCATTGTC
TCTGATCGAGACCCGCGGTTCACCGCTACGTTCTGGCAGACGCTGTTTCGCCTTCTCGGCACACGACTGTCGATGGCGGACCACCCGCAGACGGATGGCC
AGACGGAGCGCGTCAATCGCGTGCTCGAAGACACGCTCCGCAGTATCTGCGCGGAGATGCCCCGCTCTTGGGCTGATCGCTTGCCCATGGTTGAGTTCGC
ACTCAACAATGCGGTACATGCATCGGCGGGCTTTACGCCCTTTTACCTGAACGGGTTGCGCCACCCTCAGGTGCCGCTCACATTACGAGGCAGTACCGGG
GCTTCGGTCCTAAGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGTCCAGCCACCTTGCGGAAGCAACTGTCCTCGTTTGCCG
AAGACAGGCTGAACATAATCAGCAGGGTGCGAGACACCATGGCGCCAGCCCAAGATAAACAGAAGGAGTACTCTGACCGAAATGGAAGAGGAAACATGAA
CGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAGAAACCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCAACAAGCTGAAGCACCGCTTCATT
GGACCCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTG