Description :
From Genome Similarity Track
Location :
scaffold_169:29650- 34955
Transcript NameFunction/comments
Pl_108372hypothetical protein PHYSODRAFT_320443
Pl_108373tRNA pseudouridine synthase
Pl_108374hypothetical protein PHYSODRAFT_320441

Sequence
5305 bases(100 bases per row)
TACTCTGGACCTACAGGCAGACACCGCTTCCCTGTGCCAACAGTACCTTCGAGGTTTTCGTTTACTGCAGGAGGAGGTTGCTCATAAACGTCGTTAGATA
TTCCATCGACTCCATGTTCGCAACAAATCTCGCTCATGGTGTATCTGAACATGATTAATCCAAGAATCTCATGTATTGCTGAGCACAATATCTCCTTTGG
ATTTAGCTAGGTTATTCACAACGATAAGAAGTTCTTATCGAGAACTGCTGAATGCAAGTAGTTTTTTCCGAACTTTACAGCCAAAAGTTGTTTTACCTTT
TTCTATTGCTTTCTTCCCTTGGGTATCTCCAGCTGTCGAAGCTCGACGGGTGGAAATCTTTCAACCTGACTGACTAGCTAAATGAAATTCACTTACTCGT
TCAGTCCTTCCTTAATACCGGCAACAACCTGTTGGTATTGTGGAAATTGGGGAATGTCTCCCGAATAGACGAGGCTAGGCGGGTTCTGCATGGCCTCCTT
CACAACTCGCTGGATGTCTGCGGCCGTAACCTGGTCAATCTTGGCGCAAACAGACTCAGGCGTCTCACGCTCGCCATACGTAAGCAGCTGGCGACCGATG
TCTTCATACAGGATCATACGGGACTCGAGGTTCATGAGCACAGACGATTTGAGTTGATTCTTGGCACGGGCAAGTTCAACAGCGTCGACGGGTCGGTTGG
CGACACTTAGCATCTGATTGCATAACAGCGCCACGAGGTTGCTGGTATGCGACGGGATGCAAGCACCGTAAATGCCAAGAAGACCCACGTCAGCATGAAT
GGACGAAAACGCAAAAGCTGACTCGACCCAGTAGAACCGGTTCAAAACACTCGTGTACAACCGTGAGTACATGCCTTTACCAGGACCACCAGCAGAAAAG
CTGTCACCACCTCCAAGAAGTGTGTGCAGCACACAGATGGGAACAAGGTCTTCATCGTGCCAGCCACCTGTGGGAAACGCGAGAGCTGCGTACGAGAACT
CCGACTCTGGGTTCGGCAGTGGGTAAAGTCCTCCTGTGTAAATCACTGGCTCCAGTGTCTCCGGACTCGACGGCGTTGCCAACGGCGTACCAGACGGAGC
CACAGGCACATTCGAAAAGAATTTTTCTGCGTACTTGACCAGCCGTGCGTGGTCAACACCGGAACCAGCAAGGACCATCTTCTGCGCGACAAAGTGCTCG
TCACGGAACTTCTTGACCTTCTCCACGGTGAGCGCATCGATCTTATCCAATGGGCATTGCAGTGGTCGGCCGAGCGGTGTATCAGCACCGTACGCAGCAG
CGTGGATGAACTCCTGTAGCATTGCAGGTGGGTTCTCCATCAGATCCTCTGTCTGGATGCGCATAATGGCCTTGATGCCCTCCATCTCCTCAGGCACCAG
ATCCACATTGAGGATGGCATCAGCCAGTAGTTCCAATCCCTTCTCCACGTTGTCGCGCAGCAGGTCGATTGTGTAGATGATCTGCTCCCGGCCGCAAGAG
GACGTCGTGAGAGCGCCAATGTCCTCGATCTCATGGACCAATTGCGCGTGCGAGCGTGATGTGGTGCTCTTAAAGCCCAAGTGCTCCAACAGGTGACTGT
TCCCCACGCTGTCGTCGTCCTCGAACCGGCTGCCGGCATCGATGAAGATGCCGAGTGTGGCTGCCTGACCGTACGTCTCTTGCGAGATGACGCGCAGACC
CGAGGGCAGCACAGAGATCTCCGTCTGCGGGGGCTTTAGTTGGCTCGCAGGCTTGAGTTGGGGCAGACCAGGCAGCTCCTGCTCTAGCGACAGCTGCGGC
TTGGCGTCCTTGGTTACTTCGGGTCGGAGGATGTCCTTCGGATCCACGTCCTGTGTCGGCGTGTGCGCCTGAGAGAAGGCTCGTGCATGTGGAGTCAGCG
ACTGCAGCGCCGCAAAGCGGCTGTTCGAGGACTTGACGGCCAATTGCGCCGCACGACGCAGCGTCTGGAGGCTTCGCAGCGACACCATGGCGACTATCTT
GCTATGGTGGTGGGTAAGGCGACTGACCTCCGTCCGACCCTCAAAATGGTGTGTCGTACAGCAACCATGTGGTTTCTGCGCATCACCAGCCATTTTGCCA
TTGACAAGCTCCATGGCAGGCAAGCGCAAGAAGACGCACTGGGCTGTGCGCCGTAAGAACAAACAAGCGCGTCGCGATGGAGGAGACGAGCAGGACAAAG
AGTCACAGCCAGACCGCCGTGCTGACCGCTCAGACGCCATCCACCCAGGCTCCTATGCAGCACAGCACCAACGCTCTGATACTCCAGCGGATGCGCCAGC
CTTACCAACTAAGCGCCGCTACGGCCTGTGGGTGGCTTTCTGCGGCAAGAATTACAGCGGTATGCAAATGAATGAGGGCGTGAAAACCATCGAGGCGGAG
CTGGAGCGCGCGCTATTCGAAGCTGGCGGCATCGCCGAGAGCAACTACGGATTCCTGCAGAAGATCGGATGGAGCCGCGCAGCCCGCACAGACAAAGGCG
TCCACGCTGCAGGTCAACTACTGACAGCTAAGTTGCACGTAGGTGACGATATCCCGGCCTTTGTTACCAAGGTGAACGGCGCTCTGCCCGAGGACATCCG
AGTGATGCACATGGTGACGGTCACCAAGAACTTCAACGCCAAGATGACATGCGATCAGCGCACCTATGAGTACCTGGCGCCCACGTTTATATTTGGCAAA
CGAACTCGTGGTGCTGTTCCGAAGAATGCAAAGAAGGGTGAAGAGAAGGAGGCAGAAGCTGCGACCCAGTGGCCGTCGGACCTTCGAGACTCCGATGAAG
GTTTGAACGACAATGTGGAGATTGATAGTACGACACTGGAGGCTCACAAAGCCTTCCGACTGAGTGACGAGACGCTGGAACAGCTCAATGCCACGCTGAA
GCAGTATGTGGGAACCCACAACTTCCACAATTTTACGTCTAAGATGGAACCCTCAAATCCTCAGGCAAATCGCTTTATTATTTCGTTCGAGGCTGAGCGC
CCGTTCGTGCAAAATGACATGGAGTGGGTACGTCTACGCGTGGTTGGACAGAGTTTCTTGCTTCACCATATCCGAAAAATGATCGGTACTGCTGTGGAGA
TCGTCTCGGGTGTTACTGACACCTCAACTATCGAACGTGCCATGGAGCTGACCAAAATGGACTTGCCTAAGGCACCCAGTGTAGGGCTATACCTAGCGCA
AGCTCACTTCGAGGTGTACAACATGAAGATGGAGGAGTCGATCCAGACATCGCACCCTCCACTTGATCTAAAAGAGCCCGCTGTTGCAGCAGCCGTCGAG
CAGTTCAAGCGTGACTATATTTTTGACCACATTATGAAACACGAAGAGCGCACCCGCACATACGCAAAATGGCTGCGTACTATGGAGGGTTTGCCATTTG
ATTACGTTGCCAAGCCATACTTCGAGTGGAAGAAGGAGAAAGAAGAAGAAGCAGCTCGAACGGATCGTGCCGGTAGGCGGGAATTAGCGAAGGCAGCGCG
TGCTGAGGTCGGTGCTCAGCCAAACAAAACAACAGACGTGTCAACTGCACAAGCCGAATTAAAGCTGACAGAGGAACCTTCTACTACCTGAGTCTCAAGA
GCGTGTTGGTATTTTCGTGAATAGACTGGTCTCGTTGGTCGGCACTGCCAAGTGTGAGAGTACCCCAGCGGCTCAGCTCTCATAACGGTTGTTTCACTCG
CAGTTCAATTCCTTTAATGAAACCATCGGCATATTTTTAGGGAACTAACTGCTTTGCCATGTTTGTATTTTCTTGTGAAAGTCTAGGCAACGCCTGGTTA
GTGTGTGTGGAGTGTGGTGGTCTAGTGTGCACTCGTCGTTCGTAGTCACCTACCTAGTTGGATCACCGCTGTCTCGTTTAAGGGAATCACCATGCGAAGC
TCTAGCTCCAGAGGTTCCATGGAGCTTTCAGCTACAGCTCTGAAACTCTCGAAGGTAATTGAGCGCGAAGCCAAACGGCGATCAGCACTACACAGCTCCA
GGTTGTTTCATGTCCAAGCCCATTTTCCGTCATTTTCTCGCAAGTCTGCTGACCGACCTCAGCGGAGTCAGCGAAGTGCTCGCAGTCGACGGTCTATGTC
CGTAACTCCAACACCGGAGGAAGACTCTGTGGCATCAGCAGAGGGTAATAGTGGACCACAATTGTTATCCTCTCCTGACTTGGCACGGGACTCCAAAGCA
ACTTTCACGCGACAAGCCTCCAGATCTATGTCCGAGACAGCGTCAGAGGAAGTGCATGTGGGTTGCATGCAGAAATGCTGGGACTTTTTTGAGGATCCTC
AATCATCCACACCGGCATATTACTTTTCGTTGAGCATTTATGGCTTTATCATTCTTTCAACGTTTGTATTTATCGCTGAAACGGAGGCAACTTTTGATCC
TTACATGGTGGTGCTTACAACCCTGGAGGCGATTTGTGCTGGTGTCTTCTCATTTGAACTTATTGCTCGCTTTCTCGTCTGCCCCAGCAAAGTGGCCTTC
ATCAGAGGTGCGTGTTTAACATGAATTAAGGATTATGCAATGAACTCGAACTAATGGCAAATGTCTACACATCAGACTTCTCGAACTGGGTGGACTTTGT
GGCAGTATTCCCGTTTTACATGGAGTCGTTATTGAATGTTGACAATGCTGGGTCTTTCGGCGCCATTAGAATAGTGCGGCTTACGCGAGTTGCGCGTGTC
TTAAAGATGTCACGGTATTCGTCAGCGATTCAAGTCTTCACACAAGCAATCTCCATCAGCATCAAACCCCTGACCATGCTAATCTTTCTCATGTCCATTG
CCATGATTATTTTTTCGTCGGCAATTTATTTCGCCGAGTTTACCGCCGATGGTTGCCGGGCAGACGGATGGATGGGCGCTTGTGATACTGATTCTTCCGG
AGACGTCAATACGACCGATGTGTCATACTCAGTGTCTGTAGCAGCAGCAGTAGCGTCGGTATCTTCTAGCGATACTTGTGTGTGCGTGGATCCAAACCCA
TACCAAGGCATTGCGACATCCTTCTGGTGGTGCATCGTGACCATGTCCACTGTGGGCTATGGTGACATGACCCCAGTGACCTGGACTGGGAAGGTGGTTG
GATGCTGTACGGTTCTTACAGGTATGCTAGTGCTCGCATTGCCGATCACGGTCATTGGCACAAACTTCCAAAAGGTCATGAAGTCTGTCATGCATGAAAC
CATGAAGAGCAACGTGGACTACCTTAAAGGAAAGCGCATGATTTGCCGCAATGAGATCGAAGCTATCTTACAGCGCTTTCACGCTGTAACGGAGGGAATT
CATCT