Description :
From Genome Similarity Track
Location :
scaffold_258:29649- 30660
Transcript NameFunction/comments
Pl_106939hypothetical protein PHYSODRAFT_553158

Sequence
1011 bases(100 bases per row)
CCGTCTCGACGGTCTTCCAGGCCGCCAAAATGCTCTCCAAGAACTGGTTCCGCGTCACTTCACTAGGTCTCGTAGGTAATTGACACATGGGACATTGGGA
ATTGTTCTGCTTGAGATGCAGAAGGATGCACGGGCGACAGAAGTTGTGTTTGCAGTCGAGACACTGGGGATCCTGGAATATTTGACCACTACAGTTGAAG
AGCGTTAGACCATGGACATGTGCGTCACAAGTGTATTGCCTACCATAGTGTACAACTGAGCTGCTCGCGGATGAGGCGGATGGCCTCCAGCCGAGGAGAC
GACAGCAGCGCCATAACGATGATAAACCTTTCAACCGGTATACCGAACTGGTCAACATTCGAACCGGTAGCCGGAGTGCGACTACCAGGAGTGTACTACA
ATTTGTAGTACAAAGGTTTAGTAGTGTTCGAGGAGAACACCTTTTGTCATTAAGCCAGTGGGGTAGACAAGGAGAATGGGAGTCTACTGTTGTCCCTTAT
TGCAGTCGTTAGTAGATATCTATCACCATTCGTCTCGGATGATTGGCACAGAGACTGAGAGAGTCTGGGTCTTGTGGTCCCATTTGGCTTGACCTTCGAG
GTGGCGGACGGGGTATGGGAGATGCAACATGAGCTTCCTGAAATACATGTTTTCGTTAGTATCTTGTCGTGAATAAGACCATTGTACGTACAATGTGGAA
GACAATAGCAGCAGTTTCTGTCGCTTGACGTCGAGTTCGATGTCTTCGAGGCGGTGACCGGGACACTCCATACGAACTACCATTGCTTCGCAGTGAGCTG
ATGATGGGTCTTTGTCGCTGAGTCCGAGGAAAACGTCCTCTGTCATCACGCTCTGCTTATAGAGGATCTCAAACCTGAAGCGGACATTCATGAGGAGCGG
TGAATTCTAGATACAGTGGGGATATTCGTACTTGGGGCGTGTACGGGTATCGAACACGTCGTCTTCGTCGTCGCTAGGTACTTCGTCCATCGACCAAATC
GCTTTCGGATC