Description :
From Genome Similarity Track
Location :
contig_38:296410- 301295
Transcript NameFunction/comments
g7111.t1acyltransferase, putative

Sequence
4885 bases(100 bases per row)
CACGAGCTCGAGATCGCGAGCTCGGTGGAGCCAGCGCCTCGGTGGCAAGCACGCCGGTCCCACGATCATGCAGCATAGGGAATGGCCGCCCGTGCGTGCA
CGGCCCAAGCTATCATCGCTGGCCAAGAACATGGCGAGCTTCCAGCAGCACGGGCTCCGCTACCGCTGACCGTTTCGCAGCAAGTCGCAGGCAACGTGGC
TCGTTACGCTGCTGTGCCTGTCGCCTTGAGCGTCGATCTTGCTCGTCGACATGGTCCGCCCTCACTGCTGAGCCGAGCGGAGCGCTCAGTCTTTGCGATT
GCTGACGGACAGCAACAATTTTCAGGTTGTGCTGTTGTGCTGCGACTGTCCACATTGGGTGTGAGCCACAAACCTCTCAATATGATATTATCGACTTGCG
CAGGGGTAGAGTGCGTATCCCACAGCAAAGGACCTTCCTTCTGGGATACTCGACCGAGCGTCATCGAGTCCTTTTACATTTCTCACCGCCGCCGAGCTTA
CGGCATTCACCTCCTCGCTGTGCGTCATTGCACCTTTCATCGCGCCGAGCTCAGATACACAGCAACAAACATGCTGTCGACGCTGATGTGGGTCGCGCTG
GCGGTCGCGGTGCTCGTGACCCAGGGCTACATGATCGTGGCGCCTTCCTGCGGCTCTTGCTCCACACGTACTTCCGCAAAATCGTGGTCTACGGACTCAA
CAATTTCCCGCGCGAAGGGCCCGTGATCCTGTGCCCGAACCACCCCAATATGCTCGTGGACGCCATCCTCGTTATGACTGAAGTCATTAGCCACGGCCGT
AACCCGTACGTCTGGGCCAAGGGTTCGCTCTTCAGCAACGCCGTCGTCGGGTTCCTCCTCAAGCTCTTCGGTGCTGTGCCAGTGTACCGCCCGCATCGCA
AAGAGGACAGTCTGGCAGATGTGGACTCGAACAAGACGCCAGAGGACTGGAGGCCGCTAACCGCGCCATGTTCGAGCATACGTGGCGTGTGCTTGCGGAG
GGTAACGTCATGGTGCTCTTCCCCGAAGGAACGTCCTACACAGCGCCGAAGATGCTGTCGTTGCGCACGGGCGTCGTGCGCGTGGCGACGGGGTTCGCCA
AGCACTACGACCAGCCTATCCCGGTCATTCCTCTCGGGCTCAACTACTTCAACAAGGATCACTTTCGGAGCCAAATGACGCTGGAATTTGGCCCACCCAT
GCTGATTACGCCCGACTTGGTGCAAAGCGACGCGTTCCAGGAGGATGAACACAGCGAGGTGAAGCGCTTAACCCATGAGCTGGAGGAGCGAATGCACGAC
GTTACTCTGAATGCGTCTGATTTCAGCACCATCCACGCAGCGCGAATGATGCGACGTCTCTATCTGAACACGCCAGGGTCCATTGATGCCAATAAGGAGG
TTCGCTTGACGCAGCATATTATTAACATGCTGGAGCAAGAGCCTCGCGACGACGAGCAGAAGAAGCGCATCGCAACAATTCAAGAAAAGGTATTGCGATA
CAAGGACGAGCTGGACAGGTTGCGGCTGAAAGACCAAGAGGTGAATTTGCCCGTGCCAAAGGAACAATCGCTCTTGCAGCTGTTCTTGGAGCGAATCCTC
TACCTGCTTGTCTTGCTGCCATTGGCTACACCCGGACTTTTGCTGAATTTCCCATACTATTTTATTGGTAAGTCGGGTTGTTTGCTTTGGGTGGCCTGTG
CTGGTAAGATGCTTGAACTGACATCTTCGTTGCTGTGCTGGGAATTAGGAACGAAGATGAACAGTCTCGCGGGATTCGTCGAATCAAAGTCCATGTTTAA
GATCTTCGCTGCAGGGTATGTTAGCTACTTGCCTTTCTAGGTTCATGTTGCTGCACGAATGTTGCTAACATGTCTGTTGTTGTTGTGCGCAGTGTGTTAG
TCCCCGTTCACTGGCTGGTGCTCATTCTTGCAACGTGGTACTTTCTTGGGTCTGCATATGCGTACACGCTTGCCGTGGGGCTCCCACTACTACTTTACTC
GCACATTCGTGTGCTGGAGGAAAGCCGTTCGATAGCAGAGAATGTGTATTTCCTTTTCAACATCACGGCCCATGCAGACCAGGTCGCAGTGCTTCGTAAG
GAGCGGGAGCTGTTAGCAGAAGAAGTACACGAGCTGGTTACCACGTGCGTGGACGCCAAGTTTCTCTCGGCCGTGCACAAGTCTATCGCAAGCTCTCCAG
GGAAAATCGGCTACGCCACCGCGCCTCCTCCACCAGCGACACCCTGCTTGCAAGATGACGATACCAGAGTGGCTAGAAACGTTTAACGAGTTCGTTGCGA
TCTAATGTATCTTTGTGACATTGGTCAATTGTGTTGCGCGGGCCTTCCCACCTTGAACCGAGTGACGCAGAGCCGACAACAGTCGTGACGTAGTGACGTC
CGGTTTCTCAGGAGCACCCGTAAGCAATGTGATAGCGTGTGAGCCCAGGTGTGCTCGACGGCGGACTCCAAGCGTGCTTGATTCATTCCTGTCTTTAGCT
AATTGCGGAGCTCTAGTCCGACATCATGCCGTTTTTTCTCCTTGTTTTTCAGCTCATCTGCAACATCACAACACAGGTAAGCCACCCGCTGCTGCAGAAG
CAGTAAGCTAACAGCAGCAGCAACGTACGCTTCTTGGTCTTGACAATGTTATCTCGTCTGTCCAGGAAGAACACATTGGCCTTCTTGGTGTAGGTCGTCT
GGTACCCACAAGCACAACGACAATAAAGTTACCCAATCTTCATAAACAACCCCGCCCCATCCAAAACCGCTTTAGAATCGATGTAAACGCACCCTCTTCG
GCTTCACCGCGTCCAGCTCACTCAGCGCGACCTTCAGCTGCTGAATCTGCCATTTTAAATCACGATCCATTGCCGCCAAACTCGTCAGTACAATGCACGA
GACCAGAAAGTCCACCACTGGTAGCTAGCGCACCTCTCCTCGAGCTTGTGGGCGATCTGCTGTGCTTTCCAGCGGTCGTCGCCGCCGCTCTGCTCCGTCA
CCTCTTCAATCTTGGCCATCGCTTTTTCTGAACTTGGCCAAAAATATGTGGACCACAAATGGCTTCTTTTGCAGAGCAATCAGATCAAGGCAATGAACGA
GGAAGAGGAGTTCGGCATGAGCAAGACGTCGCGGGACGCAGACCCGATGGAGCAGGAGCCCAAGGGCGCCGTGAAAGGCCACCCGGACTTTAACTTCCTG
GATACCGACGAGATCCGCGCGGGCGTGACGTCCGGGGACAAGCGTGCTGTGCCTCTGTGGATGACCAGCATGCCGGTGGAGAAGGATCCGAGCGAATGGT
CCATTTTGGAGGTGCAAATCCGCCCCGACCGTGCGTGGGAGGTCATGAAGGAGCTCATCGCCACTGTCTGCATCGGCAAAGGTCTCGTTCTGGAAGAGGA
ATGCGCTAATTCGGTGCTGTTCCGTAAGAAAGTGACGCAGGAGTCGGTGGCCCACGGTATGGCCAATACTGCCACGTTTCTCAACGTGTTCGTCCGCATC
GGCGTGTCTCCGTCCAAATTACGAGTGGTGGACATCTGCACGCTGGTGTCGAATGAGAACAAGCTGTTGGGCGGCATGATGCCGACGGGGACGAGCGCTT
TCTGGTCGACACAGGACCACAACGAACCGCACAAGTATGCGCTGGACCAACTGTTGGGGGCATTGCAGTCAACATAATGAGCCAGTGCCTCTCACTGAGT
TATTTGTACATGTCCACCCCAGAAAACTCCATGGATTCAGGTGCTGTCTACTCGTGCACGGCTGTAGCTCTTTCTGAGTTGATCCTTTTTTCTTGACATC
ACTTTGTGGACTGTTTTCTGGATTGTACAGTTGAGAATGCAGAGCTGGATGAAGGATATGTTGCAGATCTGAAAAGAGCATTCAGCAGGTGGAGTACATT
GAGGCTATTACTGTTGAAGTGATCGCTGGTAGAATACTAACATGACTGTTTGTTATCTTTTCAGTGAGATGAAAGCAAACATGAGAGACCTGTGCATCCC
GTTGGAATCGTATGCGTACGACCAGGAATTTGCGTGTGCGTTGCTAATCGGGCTACTGGAACCGACGTTGAAGAAATACGGGATCAACCTAAGTGATGTA
CGTGTAGAGGGTGAGGATCTGGAAAACAACACAGGGGAGACGGTTGCCGATGTTGAAGTTCTTTCGATAAGTAAGGACGGCCCATCATTGACTGAAGAGA
AGGTGCCTTGTCCTCATGAACCGGAGCCTTTGGACGCTACACCAAGAACCGACAAAACTCCGCCAAGTGATGGAGGCAAAATCTATGGAGAAGCAGTCTC
TGAAATGGTGCAAAAACTGTGGAGGGTATGCAAAGAAGATTGCGAGGTGAGAATCCGAGCGAAAATTGATGAGAAGCAACAACAAGTGGCCGCGCGAGTG
GAAGCCGTGCAAAGCTTGCGGACTCGGGTAATTCGGGCTGTTATGGAAGTGTAAGTTTTACTGTTACCATGCTAAATATTTAAACAAAACTGACCCAACG
AAATGCTACAGGGATGGTGCTGAAGGTTCGAGTCTCAAATCTTCACCTGCTGGTGACAGGTACGAACGAAATCGATTGCCAAATTGGTCTTTTCGTTCTC
ATGGGTGAACTCAAGCAAGTTTGGTCTGTACTTCGCAGAAATAATGTGCTTCTATACGAGGCCTCTTGCATGGTGAATGGCATTCCTGTTACGCTTCATG
TGACTTATGGGTACGGCTTGCACACTGTTCAAATGATGGGTAGTATCCCGATCAAAATTCCGGTGAGCTTACGGCAGGGCTATGTATGATGTTTTGGTGC
TTCGGTATAGCAACGTCATTTATCGGACCATGGTGCCTGTATTTGCGCACACAACGGTAGTTCCGTTTGAAGATGTTGTAAATGT