Description :
From Genome Similarity Track
Location :
contig_5:296408- 299279
Transcript NameFunction/comments
g1550.t1RAW38948.1 hypothetical protein PC110_g4809 [Phytophthora cactorum
g1551.t1hypothetical protein

Sequence
2871 bases(100 bases per row)
GGAAAGCGTCGTGTCCGCCGTGAAATGGATCGGGATCGTGTTGGGCGTGGCCGCGGTCGTCGCAGTCTGCACCATCGTCTACATGTGCTGCTACCGCACG
GACACCGGCTCGGCGCAGTCGGAGCTCATGGATGGACTGCTGCGTCGCGACCAGCTCGAAGAGACGGAGCTCGAGGACGAGGGCAAAGGCTGGCAGTGCG
TCGTCTGCGGCCTGGCCAACAGCGCCAAGCGCAAAACCTGCCTCATGTGCGGCACCAGCATCGGGTTCCTCATGAGCACGGAGCTCGGACGCCGGAAGAG
CTCGCGGATGCTGCTACGCAACAACAGTCGAGGCATCACGGGCGCCGACGTGGCCGGTGGGGCAGGAGAAGAGGAGGATATGGAGGCGTTGAGGGTGAGG
CAACGCGCGCTCTTTAAGCGCCGGATGAACACCATGGCGGCCAGGAAGAGCTTGTCGCAAAGACAGCGCGGTGCGTTCCGACGACGCCTTTGGCAACGCA
AGCAGTTGTCCGATGGCAAGTTCCATTGGGTCCGGCAAATAGTACGGATGCGGTTGACCCGCTACCGGAGCTGCAGGGTGGAGATTCAGCGCAGGCGACG
CTACCGTCGACGGCGGAAGCGACGAGTTTAGCGGGGCCCAACGGAGAGAGCGTCACAGACTACCATAACCTGCGCTCGCAAGGCTTTGTGTCGATGTACG
ACGCTACGGGGCGGCTGACGTGGACCAAAGCCGATGAAGTGTCGATTGACATGGAATCGTTTGGGAAGGGGCTTGACAATATTGACTTTGAGGTGGGCAA
TTGTGGCGATTCGTGCACGTGTGTACTTGCTTGAGGTGTTCACGGTTGTGCTTGTTTGACTGTAGGGAGTGATGGCACTAAGTTTCCGCATGAAGAAGCA
GTGGTTCTTGGTGCAGCTGTCCCGCATTGCTACCCCAGTGACTGAAGCCGTCGCCAAACTGAGTACGTCTCCATATTGTTGAGTGCCGTGGCTCCTGCAA
TGAAGCTAACCTTTTGATTGCCCACACTTGAAGCAGTGACGCGGGAACGGATCATTCAGCAGTCGCTGCAGCTTGCTGAGGCCCCACCTGACGCCCTTCA
CGCGTATTTGAAGATTACGTTTGATGGTGAGCCGGGTATCGATGCAGGTGGTCTGCTACGAGAGTGGTTCGGAATCGTCTGCAAACAGATTTTCAGTGAG
AAGATGGGCCTCTTCGTCCCCACGAAGGGCGAAGACATGAGCTATTGGATTGACCCGCTCTCTGATGAGAAGAACGAAACCCACCTGAAGCTGTTCCGCC
TAGCTGGTATCTTGATCGGCAAGGCGCTTTTTGAGGGTCTTGTGCTTGATGCCCACTTAGCTCTGCCGTTGCTAAAGCACGTGCTTGGTATTCCAATCTC
GTTCTCCGACCTTGAGTTCCTCGACGAAGAGCTGCACCGGAACTGCAAGTGGCTTCGCAGCAACAATCACGTGGAAGCTCTTTGCCTGACGTTTAGTGTG
ATGCTTGAAAATGGTACTGAGGTGGATCTCAAGGAAAATGGACGCAACGTCGACGTTACTGACGAGAACAAGGAGGAATACTTACGGTTAGTCCTCGAAC
ACCGCATGCTGGACAGCATTGCTGACCAGTTGCAAGAGTTCCTCATGGGCATCTACGATGTGGTGCCGAAGGCGCTGCTGTCTGTGTTCGACTACCAGGA
GCTTGAGCTGATCCTTTGCGGCATCCCCACTATCGACACGGCTGACTGGAAGGCGCACACTCACGTGCGCTACATCAAGCCCGAGGAAAACAGAAAAGGC
AACATCACCGAAGAAGAGCAGAACGGAGTGCTGCAGTGGTTTTGGATTGTTGTCGAGGGTCTTGCACCCGAGGAACGTGCTCGGCTGTTGCAGTTTGTCA
CTGGAACCAGTCGCGTGCCCGTCGAGGGCTTCCGTGGGCTCATGAGCTCCAGCGGTATCATCCACCAGTTCACGATCCAGCTCGTGACGCGGGGCAAGAA
GGAGAAGGCGGACCTGTTCCCCAAAGCGCACACATGCTTCAACGACTCGACTTGCCCATGTACCGCGACATGGAGGAGCTGGAACGAAGCTTGACAATGG
TATCTCAAATGGAAGTCTTTGGCTTTGGCCTCGAGTAGAGGCAATAACAAAAGTGCTATCCAATATATATGGCAGCAACTCGCGTGTGTAAGCTGTAGTT
CTGAATCATTCAAGTTGCCGTGACTTACAAAAGTGTTCGGAGTTGCGTTATTTAGTCTGGTCCTTCAGCTTGGCAATATGCGCAGCGACATCTTGCTGCA
GCATCTCCTGATGGCGTTTATCTCTGCGACCTTGAGAGCCGTCCAACGACGAACTTAGCCACGCAGGCGAGGCTGCAGCCTTCTGCTCTCCCGGCTGCTC
CTTCTTCAGAACGGCCAAAGCCGCCTCGATCTTGCTCTCACTTGTAGCCAACTTCATATTTTCTTTTGTTTTATCATCAGCAGCACTTGCAACCGTTGCG
GCGCTCTGTCGACTAGCCATAGCCTCCTCCTCCAGTCGTCGGAGGCGGTTGCGCATTTCCTGGATAGCGGATGCCAGCGCCGATTCCTTGTCCTGCTGCT
CCTGGACGGCATTTATCTCGCTCTCTACCTGCTCCATGCGGAGCGCCTCGTTCTCACGGTCCATCCGTCTCTTCACAGAGTAGAGGTACAAGCCCCAGCA
CAGTGCCAGGCCCGAAGGCGAACAAGCCGTAGAAAAGCTTACGTCTCGGAGACAGCAACTTCCTGCGGGGGGCAAACAGCACGGCGACATCAGATACAAA
GCAGTTCTAGTGTTATAGTTGGCGTTTACACACTCAAGCGCGTCCGGAGGCGCGTCCGAGAAGAGCATCTT