Description :
From Genome Similarity Track
Location :
Scaffold_53:296288- 299413
Sequence
3125 bases(100 bases per row)
CCCCAATTCCGCGGATGGACCTCGACTCACCTTGTGTACCCGTCGGCTGGCGGGTTGCACTCTTCGGTCGACTCGGATGGAGAGGAAGGTGTTTTGGTCT
TGATAGATGTAGACATGGGCCCCAAGTGGATATGCTTCGTTGGGTGGGCCGGTAGGTGGCCACTCGATCGACCCATTCGAGAGTGGACTTATAACCAGGT
TCTTCAGGTAGCTTGTCGCTCCTGGACTTTTCCTTGTTGTCTCAGTGGTGTTAAACTTCTGGCCTCTACTTTGCTCCCTGAACGTGTGGTAGGGAGAACG
TCCGATAGCTGGTCTTGAGTGGGGTGTTGCTACTCGACAAACCCACAGTCCAAATACTTCCTGGGGTCTATCTGCACTTGAATCTTACCTCGCAGCTATC
TTCGATGGAAGGGGCCAAAAATCTATCTTCCCCGGAACGGCGGGTAAACTTGCCAAGCTCCTTAGCGCACGCCGAAGTCGCGCCACGTGGATCGCAAATT
GAGTAGTATGTAATATCTTCCTATCCTTAAACTTCTTTACTATATCCTTGCCTTATTCTCTGGCTTTTTATGTGACTGGTCAGGAGCAGCAGAATCTTGA
AGGACCTCAGTCAACCGATGAGGGATCAAGGTCAACTGATGAGGGACTAAGGTCTACCGAAGAAAGACCAAGGTCTACCGATAAGGGGCCAGACCTTCGA
GTGAGGGACCGCGGTCTACCCTTAAGGACCGCGGTTCACTCTTAAGAACCGGATCCACCAATGAGAGTTTGTAGTCATCTTGTGTCAGTACTGCTTAACC
GGTACCCGAGCAACGGTTTCCTCCTTGATTAGATCTGCGGGTCCCTCTTCCCGGAGGGTCCAACCGCATTCGTGACTCTTTCTCCCAGGCGCCCTTTCCT
TGATAGTACTCCCTTTTCCTTTCGTCCTGATAGCCTCTGGGTCTATTATCTCTTTCGAACGCACTTCATCACAGCCGGCCCCTGCACTTGTTCAGCCGGA
CAGCGGTTCAAGCAAGCGAATGTCGTCATCGCCCCTCTCTCGTACGTTCGTATGCTTGATCTTCGTTAGTAGGTATTCGTCTGATTGGTGTTGTTCAATC
CATATCTTTGCCTGGGTCGGACCTACCCCCTGAGAAAACCTTTTCGGCCGACTCCACACTGGTAGTCAACCCGCTAGCCTAAAACATCGTTCCTCCATCG
GATTTTTTCACGACCGTCAACTCTTCTGCCACGTTGGTCGTGTCGGTAGGTGACCCGGTCGTCCCCACTCAATCGTCCGTCTCGATTCGTCAGCCACGTT
GTCTGCGTCGATGGGCGTCCCGGTTACTTCTACTCCGTCGGCCATCACGACCGTAAGTAGACCCATTCGCTACGCAATCCGACATCCGCAATGGGAGCCG
GACCTTTGTCGACCTTCAGGCTGCTGTGACATCTCATGCGCGCCGCATGGAGGCATGCGAGCGCCGGCTTACGTCGACCTCTTTCTCCGACGATTACCGG
ATGGGCTGATGTGGACGACTTGAAGACGATCTGCGGGACCAGTCCGCCTGGTGACCCAACTCCACGAGGTGATACAGTATGAGGTGGCGATGGTCAAACC
TCTGAGATGGCGGATCCACTATCCGAAAAGCCAGCAGACCCTTCTCGAGGCCCAGCTGGACGACGCCTCTCGAGCCCCCGGAAAGCAATCGGTTCCTCCC
AGAGCGATCACCCCGCTAAAGGAATTCAGTTTGGGGAAAGGTCCCAATTCGGACGACCCCACCTTCTCCCAGAGTTCAGGCAAGCATCCTCGTTAAACCT
CCGTCGAAGTGTCCGACCCTCAAAGAAAACCTCGAAGCTCCGCGCGCCGGTCACGCCGGCTTCGTAGCCGTGCCTTTCAGAAGCGTCTGGTGGACTTTCG
TCCCTCGTCGAGTTGGACCCCTCTGATGACGGCTCGAGCGTAGACAGCGAATTGGTGCGGGCGACCTTGGCCAAGTCGCGGTCTTCTGGTCGTCGTCCCG
CTAAGGTTGCGAAACCCTCAGCCTTGGCGGTGTCCAACCAGTCTCCCAGTTCCCCGGCCGTCAAGTGGCCGATCCGGAGTGCGAACCATCTGGGCGCCGC
GTCGGCCGTGGCTTCGACCACGGATTCTGCGATGGCCACAAAGACTTCGTTGAAACGGGCGATGTTTAGGTCTTCGGACTCCGACACCGAGTCGGTATCC
GGAAAGAAGGATACCCCGGCGACCGTTGGTGGTCCAGATCCGGATTCAGCAGAGGTCCATCTTCTTCCGCCGGCGGAGATATATTCAGGCCCAGTTACAA
GAAGACTAAATGGGATTTATTCACAGGATAATAACTATGCTAAATACAGTTCTACTTTTAACCTTATCTCGTGTTGAAACCTTCCTCTGCACGTTGCGTG
TACGTGAGATTGTGAGGCACCTGCTTATCCTGTGTTCGGAGTAAGCAGCTTGTACTGTGATAGTGCAAGCGATCGGTGCCCCGTTACACCTGGTAGCCCT
TTGTAGTCCGCTTACGACCATGAATATATTGAATGATGAAGCGGAAGACTTCCATACAACGCGTGAGAGCGTTGTAAAAAAATGTTCGACGCCCCCCAAT
CGACTAAGGCTCGCAGTGACATGTTCTTGCCACTTGGATCTTCAAGGTAATGAGGGAAACCTCGTTAGCCAGATGCAGTAGCACACGATGATTGCGTGTT
GGGGTCAACCGTCTTCCAGAAGCCTTAAAATTCACTTGACGTTGCTGGATCAGTAGGGTGCTTCGCACCTACTGGACCCGAACGTTTTCGACTGTCCGTT
ACAGTTTTACGCTTACTCAAAGGCTTCATACCCACGCGTTGGACCCTTCTTGGCCACTTGGCCGCTTGGCGGTTGCTGTTGACTGCAGTACGTGGTACCG
CGTTCCGGGCACTGCTTTGGTATGCATAATGCCGTCTTTTTACATCTATTGCGTATTCAAAATATCGTATAATCGGTAACGCGAGAGCTTTCACTCCCCG
AGTAAAAGAGGTCCATTGCTTCTGGATATTCATTTTCCTGTCTCCTCGGAGGACTAAAGGAATTGAAATTCACGTGATCTTGTTTCACGCTGAAAACTTC
CTTCATCGGTTACAATTTATTCCGG