Description :
From Genome Similarity Track
Location :
Scaffold_454:29624- 31955
Sequence
2331 bases(100 bases per row)
CTCTCGCTCCACCAGGTCCAGGCGGCCCGGAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCA
ATCTCAAGCACGAGGACACGTTGACGGAGGCGATCAACCTCAGGGTCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCG
CCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATAGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCGACGGTGTC
GCGGTAAGCGACAGCTCCTCATGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGT
CGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGAAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGCCGATAAATACATACCGTACCCGCGCTCAT
CGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGCTCCAGGAT
GTGGGACGGCTGCTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGAGTACTTAAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGAACTCCAA
GTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAAGAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGG
AAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGA
AGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGGACCTCTAAGAAGAGGTCAGCTCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATG
GCAGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAACTCCTCCTGCTACTGGTCGAGGTCATTCGAGACCTCCC
AAGGCTCAACGATAGCACCCTCCTCTTCCTCTTCTTCATCCTTATCCTCCTCTTCATCCGAGGAGCCGAGGATACTCCGATAGGAGCGACGAGTCTCCTT
CTCCTCGCGGAGTGAAGACTTAGAGGCAGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTGGATGCCTTAGCACGCGCAAGACCCTCGGCAAGCGAG
AGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCGGCTTTGGGAGCGTCCTTAGCCTTGGCGGCCGGACTCTCAGAGCGCACAGAGGTCCTAGGGCTGT
GATCACCTTGATCACTAGCGAGCGACTACGCTGTCATCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGTCCGCAGGAGCATCGTGAGTGC
TCTCGGACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCATGTTCCACGAACCGAGGGCTCGGACGATTGTCTGAAGATAAGGGCGACGGGCTGCGGCG
CTTGCTTGCGCGCTTGTCCACAGCCGCGTTACCCGAGGAGCCAATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCAGAGCCTTTGCCGTGAGGC
TTAGTGCTCTTGGCTTGCGCCTTACCGGCAGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTTGCAGTGCCACGAGGCATGATAACGGTCGAAGTGGAGA
CCTAGACGAAGAGCGCACAGTTTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAA
TGAGAGTTTGTGACGAACACCTCTTCATTTTGATTGGTCGGTAAACCGAACCTAAGTGGAGGAGGATGTAACGGGGTACGTAGCCCTAGGTGTACCCTGG
TTACATGAAGTGTGATACTTCACATTTCAGGAGTATGACACGTCATACTCCAGGATATTTGGTACAAGGTACCAAGGTCGTTCAAAGCCAACCATTGGTT
AAATGACATTGCATTTCTATAGGTAACTAATAGTTTGTATTAAAGCCAACCTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTC
ACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGCGTTTGTATACTATCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGT
GACCCCGTCACATGTACTGTCAGCGCCAGTA