Description :
From Genome Similarity Track
Location :
scaffold_38:296232- 301113
Transcript NameFunction/comments
g12729.t1 hypothetical protein PHYSODRAFT_343758
g12730.t1 acyltransferase, putative

Sequence
4881 bases(100 bases per row)
GCGCACGAGACGCCGCGCGTGGCGAGCTTGTGCTGGATGTCCTTGCGCAGCTGCAGGAACTGCGAGTAGCGGCGGTTGACGGTCCACTCCTGGTTGGTGG
GCTGCACGAGCATGCAGATGCTGTACAGCGTGTGCGTGGGCCGGTTGAGCGCCGCCGGGATGAACACCTGCACGCCGCTCTGGAACAAGCTCATTGGTGG
CTGGGCTGGGCTGTCCTGCGTCCGGTTCCTGCGCTACGCTACGCTAAATGGCGCACTGCAGTGGCGTCGCAATTCCGCGCTTTGGACAGGCGTCGCCGGC
GTGGAGGGGGTATGGTACAACGAACAGCTCGGGCTGCAAGGGGCGGGGTTGTGTACGTCGCCTCTGAGAGTTGACGTGGGGCGGTTGGCTGGAAAGACCG
ACTGCGGACGCACGAGCTGACGCTGGATAGTGCTGGGCTCCCCCACCCGATATGCGACCGGTCGAGGCGTGCGAAATCGGCCCGTTTGCGTCGCCACGAC
AGCGTCAAAGCCCACGAGACCACCGCGCCACCTGGGGTTTGTATGATGTTTCAAGCGCAAGGGCTCAGGGGTCAAGACACAAGTTGCGCACGTTACAAGT
GTACTTCCTTCCTACTGAAACTGGAGCCACTGAACCAGCAGCCTGCTACAGGCCAGCAAGCACAGGCCGCAATCCAGGGCTGATAGCAAAGTGCACTCTT
CTCCTACGCGCCAGCCTCGCTTTCGAGCCGACACCGACTCGCGTGCGCTCCGGCTACACGTGCTGGTTGCAGCCGTTTGCTGCCTGCAAGCAAGCAGGCT
ATCGAAAATCGTCCTCGAAGCCGCACGAGCTCGAGATCGCGAGCTCGGTGGAGCCAGCGCCTCGGTGGCAAGCACGCCGGTCCCACGATCATGCAGCATA
GGGAATGGCCGCCCGTGCGTGCACGGCCCAAGCTATCATCGCTGGCCAAGAACATGGCGAGCTTCCAGCAGCACGGGCTCCGCTACCGCTGACCGTTTCG
CAGCAAGTCGCAGGCAACGTGGCTCGTTACGCTGCTGTGCCTGTCGCCTTGAGCGTCGATCTTGCTCGTCGACATGGTCCGCCCTCACTGCTGAGCCGAG
CGGAGCGCTCAGTCTTTGCGATTGCTGACGGACAGCAACAATTTTCAGGTTGTGCTGTTGTGCTGCGACTGTCCACATTGGTGTGTGAGCCACAAACCTT
CTCAATATGATATTATCGACTTGCGCAGGGGTAGAGTGCGTATCCCACAGCAAAGGACCTTCCTTCTGGGATACTCGACCGAGCGTCATCGAGTCCTTTT
ACATTTCTCACCGCCGCCGAGCTTACGGCATTCACCTCCTCGCTGTGCGTCATTGCACCTTTCATCGCGCCGAGCTCAGATACACAGCAACAAACATGCT
GTCGACGCTGATGTGGGTCGCGCTGGCGGTCGCGGTGCTCGTGACCCAGGGCTACATGATCGTGGCGCGCTTCCTGCGGCTCTTGCTCCACACGTACTTC
CGCAAAATCGTGGTCTACGGACTCAACAATTTCCCGCGCGAAGGGCCCGTGATCCTGTGCCCGAACCACCCCAATATGCTCGTGGACGCCATCCTCGTTA
TGACTGAAGTCATTAGCCACGGCCGTAACCCGTACGTCTGGGCCAAGGGTTCGCTCTTCAGCAACGCCGTCGTCGGGTTCCTCCTCAAGCTCTTCGGTGC
TGTGCCAGTGTACCGCCCGCATCGCAAAGAGGACAGTCTGGCAGATGTGGACTCGAACAAGACGCCAGAGGAACTGGAGGCCGCTAACCGCGCCATGTTC
GAGCATACGTGGCGTGTGCTTGCGGAGGGTAACGTCATGGTGCTCTTCCCCGAAGGAACGTCCTACACAGCGCCGAAGATGCTGTCGTTGCGCACGGGCG
TCGTGCGCGTGGCGACGGGGTTCGCCAAGCACTACGACCAGCCTATCCCGGTCATTCCTCTCGGGCTCAACTACTTCAACAAGGATCACTTTCGGAGCCA
AATGACGCTGGAATTTGGCCCACCCATGCTGATTACGCCCGACTTGGTGCAAAGCGACGCGTTCCAGGAGGATGAACACAGCGAGGTGAAGCGCTTAACC
CATGAGCTGGAGGAGCGAATGCACGACGTTACTCTGAATGCGTCTGATTTCAGCACCATCCACGCAGCGCGAATGATGCGACGTCTCTATCTGAACACGC
CAGGGTCCATTGATGCCAATAAGGAGGTTCGCTTGACGCAGTATATTATTAACATGCTGGAGCAAGAGCCTCGCGACGACGAGCAGAAGAAGCGCATCGC
AACAATTCAAGAAAAGGTATTGCGATACAAGGACGAGCTGGACAGGTTGCGGCTGAAAGACCAAGAGGTGAATTTGCCCGTGCCAAAGGAACAATCGCTC
TTGCAGCTGTTCTTGGAGCGAATCCTCTACCTGCTTGTCTTGCTGCCATTGGCTACACCCGGACTTTTGCTGAATTTCCCATACTATTTTATTGGTAAGT
CGGGTTGTTTGCTTTGGGTGACCTGTGCTGGTAAGATGCTTGAACTGACATCTTCGTTGCTGTGCTGGGAATCAGGAACGAAGATGAACAGTCTCGCGGG
ATTCGTCGAATCAAAGTCCATGTTTAAGATCTTCGCTGCAGGGTATGTTAGCTACTTGCCTTTCTAGGTTCATGTTGCTGCACGAATGTTGCTAACATGT
CTGTTGTTGTTGTGCGCAGTGTGTTAGTCCCCGTTCACTGGCTGGTGCTCATTCTTGCAACGTGGTACTTTCTTGGGTCTGCATATGCGTACACGCTTGC
CGTGGGGCTCCCACTACTACTTTACTCGCACATTCGTGTGCTGGAGGAAAGCCGTTCGATAGCAGAGAATGTGTATTTCCTTTTCAACATCACGGCCCAT
GCAGACCAGGTCGCAGTGCTTCGTAAGGAGCGGGAGCTGTTAGCAGAAGAAGTACACGAGCTGGTTACCACGTGCGTGGACGCCAAGTTTCTCTCGGCCG
TGCACAAGTCTATCGCAAGCTCTCCAGGGAAAAATCGGCTACGCCACCGCGCCTCCTCCACCAGCGACACCCTGCTTGCAAGATGACGACACCAGAGTGG
CTAGAAACGTTTAACGAGTTCGTTGCGATCTAATGTATCTTTGTGACATTGGTCAATTGTGTTGCGCGGGCCTTCCCACCTTGAACCGAGTGACGCAGAG
CCGACAACAGTCGTGACGTAGTGACGTCCGGTTTCTCAGGAGCACCCGTAAGCAATGTGATAGCGTGTGAGCCCAGGTGTGCTCGACGGCGGACTCCAAG
CGTGCTTGATTCATTCCTGTCTTTAGCTAATTGCGGAGCTCTAGTCCGACATCATGCCGTTTTTTCTCCTTGTTTTTCAGCTCATCTGCAACATCACAAC
ACAGGTAAGCCTACCCGCTGCTGCAGAAGCAGTAAGCTAACAGCAGCAGCAACGTACGCTTCTTGGTCTTGACAATGTTATCTCGTCTGTCCAGGAAGAA
CACATTGGCCTTCTTGGTGTAGGTCGTCTGGTACCCACAAGCACAACGACAATAAAGTTACCCAATCTTCATAAACAACCCCGCCCCATCCAAAACCGCT
TTAGAATCGATGTAAACGCACCCTCTTCGGCTTCACCGCGTCCAGCTCACTCAGCGCGACCTTCAGCTGCTGAATCTGCCATTTTAAATCACGATCCATT
GCCGCCAAACTTGTCAGTACAATTGTACTATGCACGAGACCAGAATGTCCACCACTGGTAGCTAACGCACCTCTCCATCGAGCTTGTGGGCGATCTGCTG
TGCTTTCCAGCGGTCGTCGCCGCCGCTCTGCTCCGTCACCTCTTCAATCTTGGCCATCGCTTTTTCTGAACTTGGCCAAAAATATGTGGACCACAAATGG
CTTCTTTTGCAGAGCAATCAGATCAAGGCAATGAACGAGGAAGAGGAGTTCGGCATGAGCAAGACGTCGCGGGACGCAGACCCGATGGAGCAGGAGCCCA
AGGGCGCCGTGAAAGGCCACCCGGACTTTAACTTCCTGGATACCGACGAGATCCGCGCGGGCGTGACGTCCGGGGACAAGCGTGCTGTGCCTCTGTGGAT
GACCAGCATGCCGGTGGAGAAGGATCCGAGCCAATGGTCCATTTTGGAGGTGCAAATCCGCCCCGACCGTGCGTGGGAGGTCATGAAGGAGCTCATCGCC
ACTGTCTGCATCGGCAAAGGTCTCGTTCTGGAAGAGGAATGCGCTAATTCGGTGCTGTTCCGTAAGAAAGTGACGCAGGAGTCGGTGGCCCACGGTATGG
CCAATACTGCCACGTTTCTCAACGTGTTCGTCCGCATCGGCGTGTCTCCGTCCAAATTACGAGTGGTGGACATCTGCACGCTGGTGTCGAATGAGAACAA
GCTGTTGGGCGGCATGATGCCGACGGGGACGAGCGCTTTCTGGTCGACACAGGACCACAACGAACCGCACAAGTATGCGCTGGACCAACTGTTGGGGGCA
TTGCAGTCAACATTAATGAGCCAGTGCCTCTCACTGAGTTATTTGTACATGTCCACCCCAGAAAACTCCATGGATTCAGGTGCTGTCTACTCGTGCACGG
CTGTAGCTCTTTCTGAGTTGATCCTTTTTTCTTGACATCACTTTGTGGACTGTTTTCTGGATTGTACAGTTGAGAATGCAGAGCTGGATGAAGGATATGT
TGCAGATCTGAAAAGAGCATTCAGCAGGTGGAGTACATTGAGGCTATTACTGTTGAAGTGATCGCTGGTAGAATACTAACATGACTGTTTGTTATCTTTT
CAGTGAGATGAAAGCAAACATGAGAGACCTGTGCATCCCGTTGGAATCGTATGCGTACGACCAGGAATTTGCGTGTGCGTT