Description :
From Genome Similarity Track
Location :
Scaffold_761:2962- 9319
Transcript NameFunction/comments
Phyag_g7899hypothetical protein PHYSODRAFT_502426

Sequence
6357 bases(100 bases per row)
AGACTCTGTGCCAACAAAAGTATCACGTGATCAAAGAGGGAGGCAATGAGATTCATCGGCTGCTTAAGGATACGTTAAAGCACCTGCGCGTGGCCCAAGG
TAGCCCCGACTGGAGAGCTTATGTTGACTATGTCAGTGGAATCGTCGAGGATGGCCTTGCTCGAGTAATTATCCAGTCGCTTGGGCAGTTACGAGAGCAA
CTAGACCCAAAACGCATAGAAAGCGAGGACATTCCAGCTTTACTTGAAGTCGAACTGGATCTGTATGGCAAGGACATCGTGTATTTCCCGTCTATTCAGA
GCACTTCGGCCAAAACCGGGTTAGAAGATCTTATTATGCGTCGCATGGAAGCGATTCTTCATAGCTCTACTGTCTTCAAACGATTAGACAGCTCTGAGGG
CTCCTACCTGAAGGAAATGCGTGAGAACGTGCAAGTCCAATTGCTTATTGCAGATGTCTGGTCATTCCTCGACCAGAATCAGAAAGCGTGCGCCGCATTC
CGTCATGCTCTCACGAAGTACGAGTATCTGTGGACAACAGATTTGCCGCAAATGTTCCACGAGTTTCTTTCGACGGCATGGTCTCCTTATCAATACACGG
ATGAACAGGGCTCCCGTGGCAAAATCGTGTATGCCGACAGTTTGCCTAGTGCGGCATCCCCGATACTGAAAGCTGTCGCTGAAAATGAGAAGGGTGGCAC
TAAATCGGCCATTTCTGCTGGCTCCGCAATGGCGACGCTTCCCCCAATGCCCGCACAACTTCTCAACCTGGAGCGCTTTCAAGAAAAGATCAGCTTCTTT
CTCGGCTTACAGAATGAAATCTCTGAGTCGAAGCATGTGAGAGACGTAGGATTTGTGCGTGTGAACTCCCTACCGATCAAGCAGGCATTGTCGACTTGGG
TGACGAAGTGGGTATACCTGTTCACTCAGTATTTGCACGACCGAGTCGTCAACCAACTAGTGTGGGTGGACAACTTCATGCAGAAAGTAAACGCTGGGCT
AGACGTCGAGATTGACAGTGCTAACATGGAAAAAGAGAAGCCATCGCTGATGCAGTGTATGCTGCACATTCGTGACGTTCGGTGCCTGATGCGCGAAGAC
TTGCTGGTGAATTTCGCGCCGCTCAAGGATTTTGTGGCACTACTAAAACTGAATGGCATTGCGCTGGACATGTCATACGTTGGTAAAGAGAATGTCCTGG
CTTTTCTTGAGCAAGCGCCAATCCGTTGGGAAAATATGGTGAACAAGACGTTCAAGAAAAAGGAGGTGATCCAACCACTCCAGAATCAAATGATGGAATC
AATTCGACAGGAAGTTGCAGACTTCAATAGACGTCTTGCCTCGATGAAAGAAGAATTCAAGGTTGTCGCGCCGCTGCAAGCTCCCTTCGATAGTCGCTCG
ATCGCAGACGTGTATGAGCAACTGGATGGCTATAACGCAAAACTGTCCCAGGTAGAGCAGGAAGCCGCGAGACTCATAGAGCTTGAGGACATCTTTGAGC
TGGCATCCAGCAAATACGATGTGCTGACGACGCTACGTACCAATTTTATTACGCTCAAGCATATCTGGGACTTTGTTGCCCTGCTGGATTCGATTTACGT
GAACAAGTGGCAGCCTTTGCTGTGGAGTGACCTCGACGCTGACGAGCTTATGGAAGAAATCGATGAGCTTGAGAGGCATCGACGTTCTTTGTTTTCATCG
GCTCGCGGCGTGAAAGAATGGTTGATATACGACTACCTCGAGCAGAAATTGCACCAAATGACAGTTATTTTGCCTCTCGTCAAGCACCTGCATGCTCCAT
CCATGCGTGATCGACATTGGAAGAACTTGATGGTGCTTGCTCGGAAGCATTTCGATCTGTCTGGAGCTGGGGGGCTACATGCTTCAGCTATGGGAACAGT
CAGCGGAAAttctggaggtgctggcacACACAGCGGCGGCAAAAGCTCGCTGCGGTTCGAAGAGGTTCTTAAATTGGAGCTGTTCCGCTTCGTCAACGAA
GTGAACGAGCTTGTGGAAATGGCAGCCAGGGAATTtaagatcgagcagcagttgcagtcCATTGAAACGACGTGGAACGGATTCCAGCTTGAGTTTGTTC
CATATCAAACGGCAGGAAGCAATGCTTTACCCGGTGGTGGCGCTACCGTGTCTGCTGATGATAACGATGATCGTTCCCATACAACGTCAAGCACTGGCAC
CTTGGCAGCAGGTGAGGAAATGGAGGGTGACATTATGATCCTGAAAATGCCAAATGTCATCATAGAGTGTCTCGAAGAGCACCAGCTACAGCTACAAACG
ATGGCAGCCACCGGGAAGTTTGTTGCATACTTCAAAGACAAGGTGTTTGAATGGCAGTTGCGGTTGGGTAATGTTGACACGATCCTGAAGTTGTGGGTCA
CGTTGCAGCGGCAATGGTGCAGCTTGGAGTCCATTTTCCTCAGTCCTGCGGGCGACATCCAGCGACAGCTGCCATCGGAACACCAGCGCTTTGAGCATGT
TGACCAAGAAATGAAAGAGCTGTTTGTAGACGCGAGGATGTCGCCATCAGTCCTGGTTGCGTGCTGTCAACGCGAAGGGCGCGAGGTTGTGCTTCGGGAC
TTGCAGGTTGAACTGGAAGTCTGTCAGAAGGCTCTCAACCAATATTTAgacggcaagaaggacaTTTTCCCGCGCTTCTACTTTGTTTCCAACGCTTCGC
TGCTCGAAATTCTTTCAAATGGTAATTATCCGCCTCGGATCCAGCCGCACTTCGGAAATTGCTTTGATGGTATCCAGTCGTTTGAGTTTGCCAGTACCCA
CTCTAATCTAGATTCTGGAAACATCTCAGGAAGAAAGATGTCTTCAACTACGTCACCAACCACGCTAGAAGAGCGGTTCTTGGCAATGAGTATGGTTTCc
aaagaaggagaagaagtgcAGTTTACGGATTCGCTGCAGATTCATGGCACAGTTGAAAATTGGTTCAATGACCTCGTAGTCGTCATGCAGAATACACTGC
GCCAGAAGATATTCGATGCTGTTGAGGGTAGCGCTATGTGGGGTGTGGAATGCGCTCGTCACACGTGGGTGTTTGATTATCCGGCGCAAGTTGCTCTGCT
CGGAAGTCAAATCGTTTGGACAGAGGAGGTTGAAACTGCACTAGAGGAGTTCGAGAACGGCACTGAAGATGCCATCAAGAAATACTATGATTTATCAACA
GTGCGACTGGAAGAATTGATCAAGCTTGTGCAGGGTCAACTTGGAGAGCTGAACCGCCAGAAAATTATCACACTTATTACTGTCGATGTTCATGCGCGTG
ACGTAGTGCAGTCGCTGATCACGAAGAAAGTCTCGAGCTCGCTGGATTTCCAGTGGCAATCGCAGCTTCGCTACTACACGACACCGGTATCGACGAGTGC
AGGCCAAAAGAAGGAAGTTCACATTAAGATCTGCGACTTCCGCTCATTTTACAGCTACGAGTACATTGGGAATTGCGGTCGCCTGGTGATCACCCCGCTG
ACAGACCGTTGCTATGTGACCCTTACGACTGCGTTGCGACTGTGTCTTGGCGGAGCTCCAGCGGGACCAGCAGGCACAGGAAAAACAGAGACAACGAAAG
ATCTTGCTCGTGGAATGGGGCTTCAGTGCTACGTCTTCAATTGCAGTGACCAAATGAACTACCTCACCATGGCAAACATTTTCAGGGGGCTTGCTCAAAC
TGGGGCGTGGGGGTGCTTTGACGAGTTCAATCGTATCTCGGTCGAAGTGCTATCTGTGGTAGCAACCCAGGTGAAGACTGTGCTCGATGCGACGACTCTA
TTAGTTGCGTCAACAAACCGCGGACCATCAActggcggtggtgacgtTGGTTCatctggaggagaaggaagctCTCAGCAGCCTATAGCAATGCCGAGAA
CCGGCAATTGCGAGTTCTTCGGCAAAACTATTGCGTTAGTACCGACTgtcggcttcttcatcacaATGAACCCTGGATATGCAGGTCGCGCAGAACTACC
TGAAAACTTGAAGGCATTGTTCCGCTCGTGTGCAATGATCAAACCTGACTTGCAGCCAATTTGTGAAAATATGCTGATGGCGGAAGGCTTCCTGAAAGCA
CGCGTACTATCCGTTAAATTTGTGACGCTGTACGATCTCAGTAGCGAGCTGCTGTCAAAACAGAAACATTATGATTGGGGGCTGCGCTCCGTGAAGTCAG
TGCTACTTGTCGCCGGAAGTCTGCGTCGTGCACACTCTACCTTGTCCGAAGAGACCGTGCTGATGCAAGTGCTTCGAGACTTCAATACACCGCGGATTCT
CCCACCAGACTACCCTGTGTTTATGGGTTTGCTTAAGGACCTTTTCCCGAAACAAGAGCTTCCACACCTCAAGAACGATGCTTTACAGAAAAAGTGTGCT
CGAGTGTGCGCACAGAAAAAGCTTCAACCAGAAGACGGCTTTCTGAAAAAGATGATCGAGTTTGAAGACGTTCTCAAGGTGCGACACAGCGTCATGCTGA
TCGGGCCAGCTGGATGCGGTAAGAGCACCATTTGGAATACACTTGCTGCTTGCCACAACGCTGATGATGAAGGGAATGCCTTGGCGAAACAGTTGACCGT
CTTTGAGAGTGTAAATCCTAAGGCCGTCACGGCTGATGAACTCTACGGATACATGACACTTGACAATGATTGGAAAGACGGTGTCTTATCGTCTATCATG
CGGAACATGTCCAAGAACGCGACACCATTCACTGAATCGCAGACATATAAATGGGTTGTCCTAGATGGTGATATTGACGCGGTGTGGATCGAAAGTATGA
ATACTGTCATGGACGACAATAAGGTTCTCACACTTGTGTCAAACGAGCGTATTCCGTTGACAAAGTCGATGAGACTGGTGTTTGAAATTTCGTCCCTAGT
GAATGCAACGCCAGCTACTGTGTCACGAGCTGGTATCATTTACGTAGACGAGGGACACATAGGCTGGTACCCTGTAGTTGAATCCTGGCTACAGCAGCGT
GAAAGTAGTGCTGAGGCAGGCATCCTTCCTGGCCTCTTCAAGAAGTATGGGGATGGCATGCtgatggcgctggatgagACTAAAGCGGAGACTATCGTTC
CCATTGTATCCGTCGCAATGGTGGAAATGCTATGCCGGTTGCTAGACGGGTTACTGAGCACGGTTGGTGAACATGAGAAAACCCCagaagtgctggagaa
cgcgtTCATCTATTGTGGACTGTGGGCGTTCGGAGGTGCATTGGCAAGTGATAAGGGAGCAGATGATCGGATGACATTCTCGACGCACTTTAAGACCGTT
GCTAAGTATAAGTTTTCTTCTGCTACGACAAATTCTGGGTCTGCGGCTACAGGTGGAAGTGATGCAAATAGTGCGGCGATGTTGGCGAGTGGGAACGCGA
ATCTGTTTGATTTCTACTATGATGTAACGCGGAACGAGTTAGTTTACTGGGGTGATAAAGTGCCTACGTTTATGCCCATGGGAGACGTCCCATTCCACGC
TCTAGCAGTTCCCACAATGGAGTCTACGCGTGTGCATTCGGTTATCGACTTACTCTTGCGAAGAAGGAACCCGGCAATACTTGTTGGCCCCAGCGGGTCA
GGCAAGTCGTCACTGATACACGAACACATGAAAGGATTGGAAGACGACGTCACCTTTGCGTACGTGAGCATGCATCACTACATGGATGCACGAGAGCTGC
AAGCTCGTCTGGAACAGTATCTTGAGAAAAGGTCGGGTAAGGTGTATGGACCCCTTTACAACCGCAAGCTCATTTACTTCCTTGACGATCTCAACATGCC
GTTCGTCGAAGAATATGGCACGCAGACAGCACTTGCCTTGTTGAGGCAGTACATGGACTACAACTCATGGTACGACCGGCATGACCTCTCTTCGAAGAAA
ATCATCCAGGATGTTCAGTTTCTAGCTTCCATGAACCATAAGGCGGGCTCGTTCACGGTTAACCCTCGACTGCACCGCCATTTTTCAACATTGTGTGTCA
GCATGCCGTCCAAGCAAGACCTGACGACCATTTATTCTGCTCTCCTGAATCAACACGTGGCGAATTTTGCTGACAAGATCAAGAAACTCGCGCCATCTAT
TATCACAGCAACCATTGATCTGTACGCGGAGGTACGCGCGAACTTCCTACCAACCACGACTAAATTTCACTACGTGTTCAGCATGCGCGAGTTGAGCTCG
TTATTCCAAGGAATCTTCATGGCACGGCCTGAAGCGTATCTCAACAATTCGCTGCAGTTTTGTCGACTGTGGATTCACGAGTGCTTTCGTGTTTTTAGTG
ATCGCATGAGTTCTCCTGGTGAGATCCAGCGCTTTGCTGACATGGCTGTGGAGCAGA