Description :
From Genome Similarity Track
Location :
scaffold_323:2961- 5310
Transcript NameFunction/comments
g7248.t1hypothetical protein

Sequence
2349 bases(100 bases per row)
GTTCACGGCAAACTCAGCATTCGCCAAGTGTACATCCCAGTCATCCTGTAGCGGTCCCACGAAGCAGCGAAGGTACTCCTCCAGCGTGCGGTTCATCCGT
TCGGTTTGCCCGTCGCCCTGAGCTCGATGTGCTACGGTCATGCTCAGTGTCGTTCCGATGGACTTGAAGACATGTTGCCAGAATGCAGCGACGAACTTCC
GGTCGCGATCCGACACGATATTTGTGGGCATCCCATGGAGTTTCCAGATGTGGTCGATGAACAGACGAGCAACGCCTTCGGCGGTCACCGTCTTTGTTGT
AGGCACGAAGTGGCAACGCTTCGTAAGTCGGTCGAGACCACCCAGATGGAATCCACATCGTTCTTCGTTCTTGGCAAGTCTGTGATAAAGTCCATGGAGA
TTGATCGCCAGCGTTCATCAGGAATCTTCAGAGGCTCTAGCAAGCCAGGTGGCTTGGTAAGTCGTGGTTTGTTCCGCCGACAAGGTTCACAGTCAGCGAC
AAACTTCTGAATCGACTTGGACCAGTACCAGCGCTTCGCGAGAGTCAAGTACGTTCGTTCCGCACCTGGATGACCACCGTAGTTGGTGTCATGCCACTCG
CTGATGACTGTCTGCCGTAACTTCACATCGTTGGGCACGACAATCCGTGGCACGTCGTCGGATAGCGATTGGTACCACAGCAAGTCATTGGCTTCCGAAT
AGCAACGATACAACTTCTTTTGACAGTTCTTCGGTGTAGTCGTCGACTGCGTGTTGCGCTGCTTGACCGCTGCGAAGATCGCTTTGGCCTCTCTGTCTTT
CGTGTACGCCTTCTTGATCTTGGTCACCAATTCCGTGTCCGTGGTCACATCGCTGACAGCTAAGCTGAACGAGGTGTCATCGAAGCTTGTCACGCTCAAG
TCGTGGAAGAACTTGGTCTCTGGCTGCAAGTCAGGCCTTCGGCTAAGGGCATCTGCGATACCATTCTTCGCTCCCGGGAGATACGAGAACGTGGGCTGGT
ACCCCGCGAGGATGTCGTACCACCGTGCCAACCGCCGATTAGCCATCTTCTGAGTAAACAAGCCTTCAAGACTCTTTTGAACCGTCTCTACTATCGGTGG
CTTGTCCAAGCAGTAGACCCGGAAAGCTGCTAGTGCGTGGACAATTGACAAGAGTTCCTGCTGTTGCGTCGGGTAGTTAAACTCCTCTGACTTCATTTTC
CTGCTGGTGTAAGCAATTGGCTGCTCCACACCGTCGATGACTTGGAAAAGAACTCCTCCGACAGCAAACTTGCTAGCGTCAGTGCGAAGATGTATGGGCA
AGGTAACGTCCGGCAGGCGCAGTACGGGTGGGTTGCAGAGCCGACACTTCAGTTCCTTGAAATTTATCAACTGCTCTTCTCTGAAGTGAATCTTCGCATT
GCGCTTGGTTTTCTTCTTTAGAAGGTTAAACATGCTCGCGATTAACGCAGCGATATCTGGACAGAAGCGATGTACATATCCCGTCAAGCCGAGGAAGCTG
TGAAGCTCCTCTTGGGTCCGTGGAACAGGCCAGTCCTTGATGTTCTGTACCTTGTCACGATCCATGCGCACACCTTCCCTTCCAACGAAGTCTCCAAGAC
AAGGAATTTCCTCAGCACAGAAGACACACTTGGAGAGCTTGACGTACAGTTTGTTATCGCGCAAGATGTCCAACGTCTTGCGGAGCGCTTCCAAGTGAAC
TTCGATCTTCGATGACTTCGTGAAGATATAAATGTCGTCGTAGAACGACTTGGTGTTCTCCAATCCACGAAACAGTTTCGATGTCAATCGGTGCATGGTT
GCTGGCGCATTGCAAACTCCCATGGGAAGGACAAGATATTCCCAAGTCCGTTTGGCGCCTGGAAAGCCTAGAACTTGATGTCTTCTTCGCGCATGCGAAC
TTGGTAGTAAGCTGACATCAGGTCCATCGTCGAAAACCAGTATGCTCCCGCCATCGCGTCCAGGATGGCTTCTTTCCTCGTCATCGGTATACTCTGTCGT
ATCGTGTTGGAGTTCAAGTATCGATAATCGTGGACAGTCCGCCATCCGACAGGCTTCCGGACGCAGAAGGTTAGCGCAGCATGTGGGCTGATACTTGGTC
GAATGAGCTTCTTCTTCACCATGTCTTCAATCCAGAGCACGATCTCACGTTGTTGCTCAGGCGACTGCCGCCACTGTTGCCGATACATCGCAAGATTGGG
ATCTTTCACGTCGATCCGGTGCTCGATTTCACGCTTCTCCGGAAGACCTTCAGGGAGTTCAGCTCGGAACACCGTGTGCTTGTACTTCTTCAGCAGGTCA
AAGGCAGGGTTCGCTCGAAAACTTTCCCAGTCCGTCTCCAGATAGCGTT