Description :
From Genome Similarity Track
Location :
Scaffold_226:296- 3258
Transcript NameFunction/comments
Phyag_g3692hypothetical protein PHYSODRAFT_353505
Phyag_g3693hypothetical protein

Sequence
2962 bases(100 bases per row)
TCAACAGGAAGTCGTGTACCCACGCCTTTGAGCCGTGTCTTCTTTTTGTCGGCGCCCTTTCCCCCTTTGCAGCGTTCCTCAAGAGTAGCCCGTTCTCGAA
GCCATGACTCCACCAACTTTCGGCCGGAAGTGTAGACAGCAGGCCTTAGATCAGGAAAAAACTCACGTACAGCTCTTGCTACGCCTGGTGGATCCCCCAC
GGCATCGAGTACATCTAGTTTCTGCCGTGGGGTAAACGACGAACGACGTTTGCCTTGCACTGCTGGCATTGCCAAACGCCAAATGGGTGGTGTCCGACGC
TAATTGCGATTTGTACCGGAAATATGGTACTGGAGACCGTTATAAGCTGAGGGAAGGCCAAAAAAAATACGagctgtgattggctgacCGTTATAAGCCG
GGACCGGTATGAGCCGAGGAAGTCGGTAAGCTGTTACATACAAGGACGACTATACTATACATCGCACTAATGAAAACTTTAGTGCTCCTGTAGTCCTGTC
ATCCATACGCCGCTCGTAAGTCGGCGTACTCTCTTCCTCGTTCATCAATACAACTTACTTCGTCTTTTGACGCCTTTCTAAACAAactcttctttctctt
cgcCCTCCTACACTACCGCTAACCTCGCCATAATGGAGATGACGTTTCGGTTTTTTACATCGAGCACGCGGACTGGTGTTTGGTGTTCAAAAGTGAAGTT
TATCAGGTCGGCGAAGTTACCGAGGAAGATCAACGCATACCGGAGGTCCTTTCGGCTGTCAAGACGTTGCAGTTTCATACTCATTGCGACGTTTTTTATC
GCTCAGCGCTGGTTCTGACAATGACGTGGAGGCTGTCGCCAGAATTGCGTCGAATAATTCGGCCTATTTCCTTCTGTTGAAGGTCATTGGCTGGGATGTA
GTCGTGATAACGGCTCATGCCACCTCTCTATCATCGACGCTTCATGTGCAGGCCGGCATCCTTCTGGAAGAATGACTGCAATTAACCGAGAACTGGTTGA
GAATATCAACGCACGTATGTTGCTGAAGGAGTGTTCAACAAAGCATCATCAAGTTTCCTTTTATGAAAGGACTACAATTTCATGTTATGTCCTATAACAA
TATATTCCGCTTGTGTGATAGGTCAAATAGCTTTATAATATGAAATTTTGACTTGTAACATTTCAATCCGCCACGTCAAACAAAGATGGCGCAGCTACTC
CGTGCGGCAGGTACACCAGCAGAAGCCTACGATCTCGCTCGTCCTGATTACATCAGCTAAATGTCATTGCCTTGTCGTTCGTTGTGTGGTAGCGAACGGC
AATCTCGAGAAGGTGGTCGAGTTACGCAGTGACTGGGCTTTCCAGAACAAGAAGGGAGAGTCCGGTATGGCACATAGCCCAAAGCAACAAAAGATACGAA
ACAATTAAGCATCACTAACAATTACGCTATCGTCCTGGTGCTCTAGTTCTTCACGTGGCAGTGGCCGAAGATCAAGTGGAGATCGTGCAGCACCTTGTGG
CCAATGGCGCCATGCTCAAtctgcaggacaagaagcgccgcTTCACGCCGCTGATGCTGGCACTGGCTCAACAGCCGCCGAGctttgaagagatttttcA
AGCTCTGCTCAAAGGCAAACCCGACCTCAGTGTGCAGGACTCAACGGGGCAGACGGTTCTGCATCTGGCAACAGGTAAAAGAAAAATAGTCTCTTGTTTA
GTTTTTTTTATCGTGCTACGTACTGACTGTGGTGTTACTGTGCTGCAGAGTATGAGGAAGTGGagtcgttgaagctgctgctaagAGCAAAGGCCAAGGT
GGATGCAGttgacgacaagaagatgacggcgcTTCATGTCGCGGTCGGTAAGGGGAACCTCGAGATCGTCCAGCTGCTGATTGAAACGGGCCGTGCTAAT
GTTAACGTGGTGGATTCCAAGGGCAATACGCCACTGTAAGGAGCTTGCACCAGGAGGACTTCATTCCGTTTGCTGTAGCCGTCTAACGGTTGTGATGGTT
GTTGACTGTGCAGGCACTGGGCTTGCATCAAGAACGGTGATGACCAACTTGAGCTGATCAACTATTTGATCTCTAAGGTCTGTTCCATATTTTGAAACGC
TGGAGGAAAGTTGTATCTGATGTGGGCCTTGCTTTCAATGGTATTGCCGTGGATGAAGGGAGCAAAACCTCTTAAGAACACGCATGGGAACACTCCATTG
CACTCGGAGGCGATGCACTGTGATCCTACTGCAAACTGGCCCACCGCAGCTGCGGAGGCCTTGACTACTGCGTTCCCGGATTTGATTGCCGAGATCAACA
AGAACGGCTTATCTGCCCAGCAAACTTTCGAGCAAGATATCGATGCGGAAGAACCTGTGGAGGATTCTCCAGCAAAGCCGTCGAAGAAAGGCGCACGGCG
CGGCAAAGGCGACAGCGATGAGCAGTACCTGGACAAcacggctgcagcacgtgcggGTACGCCTCGAAGTGATGACCAATTGTTTGACTTTTGTCGATCT
GACTTGTGGGTACATTGTGAATGGGAATTTTATAGCTGCCATCGCacactcgaagaagaaggtttCCAAGAGTAGCAAGGAAGGCAGTGGCATGGCTCCG
TACATGTGGGTTGCCTTGATTTTTGCCATTTTGGCCGTCTTGAACGCCATGTTTTCGTCGTAGCTACATTCTCGACAATGTTACTCCTCAAAATGTAACA
TCTAGCATACAGCATTTTGAACAACGAGTTTATGATGCACTTACGACTGACAAAACCAAACTTTGGATAAGCTGTCTTAAGCTAATTGTATCAGAATTGT
TTTGGGCTTGGTGCATTCTTGCAAAATCATCAGTCACTatcagaagaagatgcatcatcgtcgtgtcgctcatcctcctcctcttcctcgtcttcttcac
caatATCGGCCTCGTCTTCAATAAACTGATTGCGACCCCGAGATCGGCCTGAGAtttcggct