Description :
From Genome Similarity Track
Location :
Scaffold_931:296- 2887
Transcript NameFunction/comments
Phyag_g8756hypothetical protein PHYSODRAFT_515195
Phyag_g8757hypothetical protein PHYSODRAFT_347295

Sequence
2591 bases(100 bases per row)
CCATTTATATACTGCCATAATTTATGGCAACTCACATATATTATGGCAATATATAAATGACCGAAATGGTACCCCCGTACCTACTTTATGGCAACTCATA
TAAATTATGACAGTAGATAAAAATGGCAAATGAAGCAACACTGACCCCGAACCCTTACGTTGCGGGTAAATTTTCAGCGTCCCCATCGCCATGTCagccg
tcgtcgacgccgtctTCGGGTCGTACGAcgtcaagaacgccaagcaGTGGAGGGACGAggacctgctgcaccgcgagcagcagaagcagtgGCGCGAGGA
CGCCATCCGCCGCGAGACCGAGTGGCGGCGTGCCGACTTGGAGCGCGAGCGCCGCGTGCTGAAGTTGGAGTCGGAGAAGCGACTGATCGACGCGCGCcat
cagcagctgcagactgtGTCACAGTTGTCGgccatcttggccttcttctccatcatgtTCATCCAGGagatcaagtcgctgaaggagGACACGAGCCAGC
CGCTGCTCATCCTGTACGGGGCAGCGGGCTGCCTCGAGTTCCTCTGTATGCTGCTGTGCACCTTGACgtgcacgttgctgctgctggcgttgacGCGGTT
CGTGACGCACACACTGGATGGAGAAGTGCGCGCGCTCTCGGACGCGGAGCTGGACACCGCGTCACCTTTTACAGATTGGTGGGTGGGCAAGTGCGAGCAG
GAGTGGCTGCTCGCGTATCAATTGTTCCAGTCAGGCGCGTCCTTCTTCCTTGTGGGCATCGCGCTCGTGAGCTGGATCGTGTTTGTCAGGTCGACGATCG
CCTCCGTCGTGGTCTCAGTGTGCTGCGCGTGCGGACTGCTGTACTACAACTTGCGGATCGCCAGTCGTTGGAGGTACTTGGCCAAACCTTCAGGAAGCCA
CAGACGCATGAGTGTGCCGTTGCCGTAGACGCGCAACAACGAAGACGGGTATTTATTGGGGAGTGTTTCCTCCTTCGTgacaacaagcagcagcatcgag
ctGTCGCCTATTAAACGATGAACATGTTTGACTCTATTTGTCGCTTACTTCTGCTTGTTGAGCTTGCACGGCTTGTGGCCGCAGTTGTGGGCGCGTGCAC
CGCAATTCCGTGCCAGGAAGAGGGTACTACCGAAGAGCGAGCCTGCCGTGATGGAGCAGTCTGCGATGGGACCCGTGACCACCACGGGGTGCAGTGAATG
CCGCAGCGTGTAGAAGGCAAAGGCGCCCTGACGGCCCTTGAGCGGCGCGAACGAGTGCGTCGGCGGCAACGCCTCCACCCGCACCGAGATCTTGCCCGTG
ATAGCATCGATGTAGGACATCTGgcgcagccgcagcgtctgcgtggGGTCTGCTATcgccttggcgatctgctccttcagtgGCGCGCTCGCCTTCACAA
ggtgctccagcagataGTCGTAGCTCCAGGTGCCAACCTCGTCCTGGCTGCCGGCCACCGTGGCGCTCGGCTCCCACGGACTCTCAATGTCGGCGTCCGC
CAGTTCGATGTCATAACCCATTTCGCGAGCGATCATGATCGACTTCTTGGCGCTACGCACGCCCATGACGTCATCTACGATATCACGCACGCTGAATTCG
TTCTTATACTCATCCATGAGATTCTTCATGATGGCGCCTAGGTCCGCCTCAGCCGGCTCAGCGAGGGCGAACACGGCGTCGAACATGGCGTGCAAGAAGC
GGCTGCCCGAGTACTCGACCCGCTGAATGTCGTCGCCCGTCTGGATGAAGTTCTGGATCGTGTTGAAAATGGGCACACCGATGGCTAGTGTCGCCTCTGG
GTCATACGTCAGCTCGTTCTGGatcgccagctcctgcaacgAGTTGTGCTGCTCTGTCGAGGCCGACGACACGTTAATGTTAGACGTCATCACGTGCGCC
TTGCGGGCCAGCCACTGCGGGTACAGGTCCTTGACGTGGTGAAAGCTGTTGGAAACATCGATGATCAGCCAGTGCGGCAGGTGGTCTGCGCACACGTGGT
CCAGGAATTTGTTCCGGTCGAACGGCACGAATTCGTCCTTGCGGGCTGCCAACGCCTCCTCGGTGATGTCACCCTcaacgtccagcagcatttgcgaGGA
AATGTGAGTGCCAATGGCACGAACTCGGATGTCTACGTTGAAACGCTGCTTCAGAAAATCGCGCTGTTGGTGGTATTGCTTCAACAGAGCAACGCCAATG
CTGTTGgtctcgttctcctcgaactcgagGCCCATGAGGCCGATGGAAAGGGTCTGATCCGACAGGAAGAACGACGAGTGCACGGCAcgtagtgcagcag
cagagtccTTGTAGTGGACCACGGCAGAGATATTGCGCTCGGACGAGCCCTGGGAGATGGCCAGCACGTTAATCTTCGCACGGCCGAGGGCACCGAAGAA
ACGAGCGCACACACCCGGGGTTTGGTTCATCTGGTcacccacagcagcgatgatACTGATCGGCGCAATGTATTCAGCCTTGTCAATGTGTCCCACGTGG
ATCTCCTTGAAGAACGTCTCGTTGATCACGTCCTTAGCCACCTCGGCGCAGTCCATGGGCACAGCGAAACAGATTGAGTGTTCCGAACTAG