Description :
From Genome Similarity Track
Location :
Scaffold_159:29598- 31838
Sequence
2240 bases(100 bases per row)
ATAGAGACGTATGTCATGAAATTGACTTGGTTCCTCGAACCAAATAATGCGCTACACGACAGTGGCCTTTACCAAAGGAACAGTGCGACGTCATTGACAA
GGTTTTAGTGCTAAGCAAGCGGCGGTAATGGTGCGCGAGAGCAAGTCACCTCATTCCACACCGACATTTTGTGTAAAAAAGCCTAATGGTAAGTGACGTA
TTGTGCATGCTTATAATAAGCTTAATGCGGCCACTATTTCGTCACAAACGCCCATTCCTAGAAAGGACGTTCTTCAGAAAAAAATAGCAGAATGTACAAT
GTACAGTGTACTCGACCGTGTCGGTGGTTATTATCAACTGCTCATGCTAGCAAGCGAAATCCCCCTTACAGCGGTTAGTACTCCAAGCGGTATGCTTCGG
GAGTGGTTGGTTATGCCCCAGGGGCTTTCCAAAGCCCCAATTACGTTTAATATTCTGGTGACGCAACTGTTCCGCCCTCACCGTGGTTGTGCACAAACAT
ATTTAGATGACACATTTGTCCATAGTCGGGCGAAACAGGGTCGGTCGGACGTGGATAACTATATCGACCATTTAGTAGTTGTGCTCGAGTGCATGCGCAC
TTATAAGATGTATGCTAATGAATCGAAATGTATCTTTGGTGCGGACGAGATTCCACCTTTTAGATGCTTCATTGGGAGGCGAGGTGTTCGGGCGGATCCT
GCAAAGGTAAGAGCCATAGTGAATTGGACATTCCCAAAGAACCAAAAAGGATCTACGCAAGTGGCTTGGCCTTGCCAGCTACTTACACAAGTTTTACGAG
AATTACACTGATATGGCTCGGTCATTATCCAATCTCCTTAAAAAGGATGTGGAGTGGTTCTGGACTAGCACCAAAGAAGAGGCTTTTAAGGCCGTAAGGA
CAGTCTCCTACATGCCCCGAATTTGGCTTTGCCGGATTCTGATCAGCCTTTCAGTGTCGTCTGTGACGCTTCAGATTTTGCCATTGGCTGTGCTCTGTTA
CAAACAGATGTTGAGGGACACGAGCGTGTCATAGCTTTTGAATCCCGTCGAGTTAAAGCTGCCAAAACAAACTATCCAGTTCATGACAAGGAGCTACTTG
CTATGAAACATGCTCTAGTCAAATTCAGAGTTCATCTGCTCGGCTCTAAGCCTTTTATAGGCTATACCGATCATTCGTCTTTACGCACGGCGACTCAATC
GCCTTATCTCTCGCAAAAGATGGTCCGTTGTCTTTCATTCTTTGCAGAATATAACTTCGCGGTGAAGCATAAGCCAGGGAGGCAAAATACCTTGGAACGA
TGCGCTGTCACGACGGCCTGACTATGAGCTGGCTCATGTCACAATTTTGGCGTCGTCAATTACTGACTTAATCCGTGCACCTTATACTAAGGATGAACAA
TGCATAGATTTGCTACGAGCTCTTGGAAGCTATGAGGTGAAAGACTCGGACATTAAATTGTCGGCACGTTCGCGTGCGATACTTTATCGATATTCTATAG
ATAACGGCTTGTTGTGCTATCGCACGGATACTGCGGACACCCCTCGTATCATTGTTCCTCTTGATGGGGAACGGAAGTATCAAATCCTATATGAGGTCCA
CGACACAGCTATTAGCGGTAATCTCGGTCGTGAGAAGACCTACAGCCTCGTTAGTCAGAGTTATTGGTAGCCCAAACTCTATAAATGGGTAAGCTCTTAT
GTGCGCACATGTGAAACGTGCAAACGGGTCAAATTTTCGACACATGTTACTGCGCCGCTGGCTAGTTTGACTGAACCTTGTGGGTGATGGGAGCCCATCA
GCATGGACTTTGTGTTTGTCCTACCAAAGGATTCGGATGTCAACATGGGTATTGTAGTCGTTGTCGACCGTTTGATCAAAATGGTTCACTTAGCGGCTGT
GCCGGATTCGATTGATGGGGAAGGTGCAGCTTCTCTGTTCGTTGATCGCGTGTTTGACAACACAGACTGCTACTGGTAATTGTCTCGGACCGAGATCCTC
TTTTCACGGATAAATTATGGAAGTACATCTTTAAGATGCTAGGCATCAGATTAGACATGTCTCCATCGGATCATTCGCAGACCGATGGTCAGGCTGAGCG
CGTTAATTGCGTCCTCGGCGATGTCTTACGCAGCGTGTGCGCTGATACGCCTTGGCGTTGAATTTCAATGCTCCCCATGGTTGAGTTCGCCATGAACAAT
TCTATCCATGCCTTGACGTGCTATACTCCGTTCCACGTGA