Description :
From Genome Similarity Track
Location :
Scaffold_58:295941- 303576
Sequence
7635 bases(100 bases per row)
ACTTCCTCTAGCGCAAGATGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTTCGAAGT
TCGTTGCCATGGATAGGAAAGACTTCTCCCATATGAACGACTCTCAGTTCAAGTCGGTTTGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAG
CCTGGTGGTGTCAACACCGGCTGAGCAGTTCGAAGGCGTCTATGCGTTTGACGCGTACGAGCAGAGGCTCATCGCGCATGTGCGGGAGAGCCTGCAGGCT
CCGGCGGCGTAAGCGAATCCGTCTCACCCGAAGCCAATACTGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTTAGTTCTGGGTCCGAG
AAGTAGAGCTCGCGATGAACGCGGCTCTGATCTCGACCGAGCAACTTCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGCCGTGCTAAGAGTTGGGTGTA
CACACGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTTACGGCGAACTACGAGTACCGCCAG
CGTTCGCGCTTCCTCTCGTGTAAACAAGGGAGGCGTGAAGTGCACGAGTACGTGCAAGAGATACGGGAGTTCACGGCGTCCCTAGTGCGAAACCCATTCA
ACGAGCACATCAAGATGGCTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGTAGTCAAGCACCCTTGAAGAGGCGAT
TCAAGTGGCTCTTCAAGAAGCGTACAACCATCGCCAGGCGCCTACGCCGGCCTCAGCGTGGCCTGGGAGCTCCTTGTCGGCTCCCGGTCGAACAAGCCCC
AACGGACCAGCTTCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGTCACTTTAAGCGACTGCCCCACTCCG
CAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGTTTACGGGGACAGGGGAACGCAGGGAACCAGTAGGGGCGGGGCGCCCTA
CTGGGGAAGAGCTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCGGAGAGTTTTCGCACTCTCGAATCGGCGAAGAGCAG
CGGCGGATTGCTCGTAATACACGGATGTGTACGGGGATACGATCATCCCTTTCGAATCTTGATTGACTCTGGGGCGTCGAAAAATTTCGCACGCCGCCAG
ACGGCTGCTCGTAATAGCAACAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGACAACGGGACGGTGTCAGTGCGACTGGCCGACGGCAAGGTCGTCACTG
CCCCCAACGTCCAAGTGGATCTGGCCGTCAACTTTGAAGACTTTGACAGCCTCGCACAGTTCACTGTTCTCGATATGGATCCATATGATATGATCCTGGG
CATGCCCTGGCTTGAGAAGCACAGGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGTGCAGTCCGACGGAGCATTGGTGAGTCAT
GTTCCCACCTCTGTCAGGACCCGGGGCACCCGCGAGGGCTGCCAGGGTACCAACGCATCCGGCAGATGCTTGGGGGTCGTCGACGTATATGACGGCTCCG
AGGATGCTTTGATGGTGGCAGCGCCCAGAAGAGGCGCTGGCCAAGTGGGTAACTCAGGTTCACAGGCGGGTAACTTAGTTCCGCAGACAGCTGCAGCTGT
CATGAACACTGACAATAGTGTGTTCAAAGTGGGTAACAGAGTTCCACTCACGGTTGACCAGACCTTAACGGAAGAGGAAGGCGTCGAACACGCTTCTCGT
GTGGGTACCACAGTACCACACGAGACCACGAGTGCCTCGGATGTCGTAGCGCCGACATCCCTAGACGTGGGCAGCAAAGCTCCACGTCACAGTCGCCGTC
GTCAACGACGCCGCCGCCGCCGCCTCAAGTCGGATCCAGACTTCGCTCAGATCGACGTCGCTTCAAGCGGCTCGGAGTCCGGGGCCCGGGCTCCTCCGAC
AAGGCCGGTGGAAGACTGTTATCACGTCTTCGATGGCAAGACCGAAATACCCGTCAAGGCATCTGGTGTCCACTTGGAGCCGTTGCCAGAGGTTGCAGAG
ATACTGAACCTGGAGGGAATGACGGTTGAGTCTTTCCTGGCCAACGTCAAGGCTGGATAGATTGCTGAGATGGTGCTCACGAGACCTGAGAGCACTCAGG
AGGAGCTGAACGCCTCCTCTGTCTTGGACGAGAACGTCCTGGAGGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAATAACCCCAA
GGATCCGGTGTATCCTTTGGTGACGGACTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGAT
CTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAG
GCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGGAAGCCGAACAGTAAGTGATGTCTGGCTCACGCTTATAACAAGCTGAA
AAGCGCAACGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGCTGTTGAACAGCATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGAC
GGATACTACCAGATCCTAATGCGAGAGAGCGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCT
TGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGCTTCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAG
CCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGCTGGACGTAATGCGAGCGAACAAGCTCTACGCCAACATCGAC
AAGTGCGTTTTCGCGTCACCAGATATTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCAT
GGCCGACGCCCCGATCCTAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTT
GTCGAGCCTCCTTCAGAAGGACATCGACGCTGCGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGTCAGTCTCCAAGAGGCCCCTGTCCTGGACC
TGCCGGATCAGACGAAGCCGTTTAACGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGTGCATTGCTGCAGACCGACACGGCTGGACACGAACGAGT
CATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGCTTCGT
GTTCACCTTCTGGGCTCTCGGCCCTTTGTGATCTACACAGACCACGCGCCCTTGAGGACGGCAGCTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGT
GGCTGTCCTTATTTGAGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTT
GGCCCACATCACGCGGGTGAAAACGGATCTATACGATCAAATACGCATGGCGTATCGGGGTGATGAGGCTGTCGCGCCTATCGTCAAGTACCTCAAGGCC
GGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAACGCTCACGGCTCCACCGATATGAGTTGAAGGGGGGCCTCCTCTATTCTCGGGTGGAGCCCA
CTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATCCTTGCGGAGGCGCATGACGCGGCCTCCAGCGGCCACTTGGGCCGCGA
GAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGGCCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTCAAA
CCCGCAGGGCACTCTTCGGCTCCACTACAAAGCCTGCTCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTAACTTCATCTTTGGGCTTCCCGCCGACG
GACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGACTGAGCAAGATAATACATCTTGCTCCTGTTCCCGTCACTGTTACGGGCGAACAAGCTGCAAG
GTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATGGGCTCGGACCGAGACCCGCGATTAACGGCTGCATTTTGGAAAGCGCTGCTC
CCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGATCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCA
GTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACACGTCCACGGGGTTCACGCCACT
CTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACGCTTCGAGGAGACACTGACTCCTCTATTCTCAGTGGGGGAGAGGCTCGGAAAGCCCTTTCC
TCCAAGGTCTCGGATGTGAGACCAGTTTTGCTGCGAAATCAAGTGGAAATTTTTATGGATACCAAGCTGAACATTGTCAGCAGAGTCCGCGATGCCATGG
CAGCGGCTTAAGATAAACAAAAGGAGTACTCAGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGGTTGGGGACTCAGAGTTGCTAGACACGAGGAA
CCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACAAACTGAAGCACCGCTTCATCGGACTATTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACC
ATCGACCTGCCAAAGTCAATGACGCACCCGACGTTCTATATTGGACGTCTTAAGCGGTACTTTGATCCGCAGGGGGTTGCTAACTCGCAGACCCACCTTG
ACCCAGCTCCTCGAAGCGAGGGCCGGTCACTGACGTCGACGAGGGCATCGGAGCAGGCACCCAAGCCTCGGTCGGAGCGGCAAGGCTGCGGTCAAGCCCG
TACGCCGGAGGGGTTCCGTACGAACGGACACCGGAGCCATACGCCGAGTACGCTGAGTACGCGGGGTACGCATCATACACGTACGTCTGAGAGTGTGCCG
CAGGCGGCTCCGAACGTGGCCGCAGAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCACATCGGACGAAGAGGCCCGGCGATCCACCCGCAGATG
CAGGCTCGCGACCTCTCGCTCCATCAGGCGGCCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGTCTGGGCGGCAGCATTACCGCCAGTCGCAAGGCCA
AGTGCAATCTCAAGCACGAGGACACGTTGGCGGAGGCGGTCAGCTTCAGGGTCCTGTGTCGAACCCGCAGTCGGATCACTCGGACGAGAGTGGCTCTCGG
GAGGCGCCGAGTACTCGTACTCGTACGGGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCTACTTCCACGTGGAGCGGATCCTCCAGGAGCAAC
GGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTTGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAA
GGCTGTCGCAATTTGGGAGCAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGACGATGAATACATACCGTACCCGC
GCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGCTCACGCTGGTC
CAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGAGTACTTAAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGAA
CTCCACGTGGCACAGTTTTCGGGCATAACCCAGGGGTATCCCCAAAGAGGATAGAGACCACCCCGCGTCTCGGGCTTCTTACCACAAGTCGTGAAGTCCT
TTAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCTGAACAAAGGCTCGTTCATAGATGCC
CCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCTCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAG
TTGATGGCATGACGGGTGCCACCACCGAGCCCCCACGCACACGCTGGGCAGCTTGGAACGCCTCCTGCTGCTGGTTGAGGTCATTCGAGACCTCCCGGGG
CTCGACGATAGCACCCTACTCTTCCTCTTCTTCCTCCTTTTCCTCCTCTTCATACGAGGAGTCGAAGATACTCCGATAGGAGCGACGAGTCTCCTTCTCC
TCGCGGAGTGGAGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCACGCGCAAGACCCTCGGCAAGCGAGAGAC
GATTGCGACAATTCTCATCGTCACCGGCTTTGGGAGCGCCCTTAGCCTTGACGGCCGGACTCTCAGAGCGCACAGAGGTCGTGGGACTGTGGTCACCTTG
ATCACTAGCGAGCGACTGCACGCTGTCGTCCTTGTGCTCACAGGGCACTGGGCTGTGCCCTCTCACAGAGCCCGCAGGAGCGTCGTGCGTGCTCTCGGAC
TCGACTTCGCCCTCACCGCCAGAGTCGAATTCACGTTCTACGAACCGAGGGTTCGGACGATTTTCTGAAGATGAGGGCGACGGGCTGCGGCGCTTGCTTG
CGCGCTTGTCCACAGCCGCGTCACCCGAGGAACCGATCGCCTCGGAGGCCATTTGAGTAGCCTCCTTCAGTGCCAAGCCTTTGCCGTGAGGCTTAGTGCT
CTTGGCTTGCGCCTTTCCGGCAGCAGCCTTGGAGCGTGTCTTCGCACCGCTCTTTGCAGTGCCACGAGGCATGATAAACGGTCGAAGTGGAAGACCTAGA
AGAAGAGCGCACAGATTGCTGCTCGAGGGTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAG
TTTGTGACGAGCACCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCTAAGTGTACCCTGGTTACAT
GAAGTGTGACACTTCACACTTCAGGAGTATGACACGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCGTTCAAAGCCAACCATTGGTTAAATGA
CATTGCATTTCTATAGGTAACTAATAGTTTGTATT