Description :
From Genome Similarity Track
Location :
scaffold_189:29594- 33057
Transcript NameFunction/comments
g5360.t1hypothetical protein
g5361.t1 conserved hypothetical protein

Sequence
3463 bases(100 bases per row)
TACATCAAGCGGGGTGGGTGCAACAGGAGCAACTGCAACGGGTACTGGGCCACTGCTTGCTCCCTCTGACTCACGCTGAGAAGCCTCGAGACGCTGCTGA
AGACGTCCGATCTTTTGTGAAAGCCGCTCAATGCCTCGATTCTTACTCACACTCACCACCGGTGGTGCCGGCGCTGACTCTGGATCAGTATCCTTAACCT
TGGGAGAAGCCACTATTGAAGCAGCACGAGTTGAGTGCAAATTTGCGGTAGGTTCTGATTGACGAACCCACTGCATCGCCTCCTCAAGAGCACGCGCTTC
ATCTTCAGGTGTCGGCGTAGGCAGTGGTTCTCCAGCATCTTGGTGGTCCAGCGACTGGACGGAAGCCGACAACAGCGAGGATCGCGACGACAGGAACTCG
AGGCTTTCGCTCGGGTGCTCACTATCTACACCTTCGCTCAGGCTAAAGGCCAAGTCGCTATCCAATCGATCCGAGATTGTGTCGGACGGTCGCACGTCAT
TGTGGCCGATAGACTCCAGCACAGCATCAAAATCCAAGCTCGACACGTCCAGCGTTTCTCGGATTTTCATAATGCGGTCGTAAATCTCATCGTACCGTTC
AGCACCGGCATCCGGATCTCCACGACCGCTCTCGAGCATCATACTGTGACGTTCTTCCTCTTCTTCGGCCTCTGAGATCGCCACGCTGATTGTGTCGCGA
ATTTGCCGAACGTGTTCCACTAATTTATCCAGAGCTTCTTTCTTCGCTTGAGCCGACATAGTCGAAGATGACAACGTGGAGTGACGAAGAACACTTGACC
GTCGCTCTCGCCTTGCAGACTCCGAAGCCGCTCGCTGATACTGTTCACTGCCATCCGACTCATATTCGTATCCGTTACCTTGAGCACTGCTTCGACTCGA
GAGTGGATGATGCCGCTGTCGAAACGGTGGAAGTGGTGAGCGCACAGGGGTCGCCTGCGATGAAGATCCACGTACTGATCCCTCTACGCCTCCTCTCCGC
AGCCCTCGGTGTTTTGGATACCGCAAGCCTCCAACGTACGTCTCAGTACCAACATTCGTCGTAGAAGTGGTTGTCTCCAGCATGCCATCCTCGCTCTCCG
TAACTCCAGACATGCTGCTGTCGCGATGACTGCCAGCTTGAGCCATACACAAGGAACACACACGCATAGCATGCGTATGCTCATCGAGAGGTTCCTCTAA
CTCCCGCAAAGGAGCACAATTGGAGCACACCACCTCTCCACACGTCGCACAGTGATGTTTCCGATGGAAGTAGAAGTTACGCAGACAAACTGCGCACGCC
TTGCGTTCCTTAGTGGAGACCCACTCCCATTCGTCCAGATACTGCAGTCTGCCCATCCGTTGTCGTTCCAGAAGTCCCTTAACGCGATGCACTGTGGCCA
CATAGTCCACCATGATCTCTTCCATCGTCATCCGCACCGCAGCAGGCACCATCGCCCCGTCAATTTGTGCAATAGAAGTAACCTTAAGGATGTTGGACTG
GTGCGTTTTAGTGATCACGATACCCGTGCGCACGAGCTGGCCCCGTAGAATATCGTATCTCTCCAGTGTAGGCACTTCTCGGTCTCTGGCAATAGACTCC
TGTACACAGAAGCCCACCACACTACTGGCTGCTGCATGGGCTTTCCTCTTTCCAGCGTATTCTAGATAGCAAAAGTCCAGACTCTTCTGTCCTTCTCTTC
TCTTCGCTTTAAGTAGACACCACTTGACAGCTCTGTAGGAATAACTGGGTTTCTTGTGCTCCGAGGACGTAGGGAACGTCAGCAACGTCTGCGTGTCCAC
GAATTCCTCTCCATGGAGATAACTCATTGCTCGGCGCGCGTCTTTTGTTTTAACCTTGGCAATAGCCTGCAGAATCTCCTCTGGCTGCACATCCACAATA
TGGACACTGGATTTCAGTAAGGTGGAGGGCTGCTGCGATGCTGGTTGCTTGGTGCTCGGCTGGATATCCAGGAATTGCGCCTTTTGCACCGATCGTCCAT
TTCGTGCCTTAATATCCGTCCAGCGGTAGACGCAATCCGCGTCGTCGATGATGCGCACGAGCTGCGCCACGCGCTCCTTGCCGAAGCGTCGGTAGTGCAT
GAGCTCCTCCACCGTCAGCACCATCTGCGGGAAGAAGCCCGAGTACAGCGGGGACGGCAGGTCCGTCGCCATTGTTGCGCGTGGTACGCGGAGAATTCCA
GAGTGAGCGGACACATTTTCGACGAGGTGACGGCTTTGCGCGTTACACCAGCGACACATAAAGTTGTTTTTTGGTACTGTAACTGACTCTTCAACGCAGA
TGGTCAACTTCAAATTGAAATGGATCGAGTTTGCCGACTTATTAGCCCCGAGACGTTTGCCGAATAGTGTGTGTTGTGTATTGAAGAGCTTGCTGCGAGT
GGAAGATAGTGTTGGCAGAGAGTTTTTGCGTTGAAGGAACTCTGGAACCTCTCCTTCGTATAGGGTCAGCGGGGCGGAGAGAACCTTCGAGCAGCGTTCT
GAAACGGAGGAGCGTTGAAGAGCTTGGGTCTTGGGCGTTGGCTCAGTAGTGACTGTCAGTTGTCGTGTAGTGTGACTGCGGTCTTGTTGTTTGTATTATC
TTAAAAGTGGACATTGGAATTGACATCTTTTGTTTTCTTTGAGAAAGAAACACAAGCTGTTGTATTGACAATTCGCTTGCCTTTTGCATAAAAGTATCTT
ATCCGCTGGGTGCGTAAGAAACGTTTTGTATAGTATCTTCTGCTGCAGCTGCCCACTTGATGCGCGAGTGCGAGCTTGGATTCAAAACTTGACATGCTTT
TTTGTATTGTGAGTCGTGGAGATCTTGCTGCTGGCGTTGGCTGACAACAACGACAGAGGAGGGATGGATTTTGGGCTGCAACCATGACTCATGCATCCAA
TTTACCTAGGTCAGTCTGCAAATTGCTCCTATGATGGGCGTTCATCTAAATCACGTACTACTACATCGTTTTTTTTCCTTCATGAATCATGGCATGATAT
TGAAAAGAGATTCTTCGCATTGATATATGCAGCTTTAGAACCTGGCCCGATGACGACGGTTGTCTCTAGGTTGAGTGCATGTTTTACCGGACGATATGGT
TTTGCTTGAAACCAGCGTACCACTGGTATGTACAGGTATGTCCAAAACAACAAAAATACAGGATTTTTAACAGGGTTCCGGTGGGGTACGTATTCGTACA
TGTATTTTTATTTCTCTCTATTCGCAGTTGTATTATTTTGCAGTTTTCTCTATGGGAAGTCTTTCGTCCGTACTGCTACTCCGGACTACAGACCGGCACC
AGCGGGAGCGCGGCACTCGGGGCAGCTGGGGTTGTGACGCAGCCATGACATGATACAATTTTCATGGTAGACGTGTGCGCAGGGCAACTTGACAGAGAAG
TTGTTGGTCACGTCAGCAGTTGCCAACACTACGTCTTCACTGTCGCTGTTGTTGCTGCTGGAA