Description :
From Genome Similarity Track
Location :
contig_5:295922- 298790
Transcript NameFunction/comments
g1341.t1hypothetical protein
g1342.t1hypothetical protein

Sequence
2868 bases(100 bases per row)
GGAAAGCGTCGTGTCCGCCGTGAAATGGATCGGGATCGTGTTGGGCGTGGCCGCGGTCGTCGCAGTCTGCACCATCGTCTACATGTGCTGCTACCGCACG
GACACCGGCTCGGCGCAGTCGGAGCTCATGGATGGACTGCTGCGTCGCGACCAGCTCGAAGAGACGGAGCTCGAGGACGAGGGCAAAGGCTGGCAGTGCG
TCGTCTGCGGCCTGGCCAACAGCGCCAAGCGCAAAACCTGCCTCATGTGCGGCACCAGCATCGGGTTCCTCATGAGCACGGAGCTCGGACGCCGGAAGAG
CTCGCGGATGCTGCTACGCAACAACAGTCGAGGCATCACGGGCGCCGACGTGGCCGGGGGCAGGAGAAGAGGAGGATATGGAGGCGTTGAGGGTGAGGCA
ACGCGCGCTCTTTAAGCGCCGGATGAACACCATGGCGGCCAGGAAGAGCTTGTCGCAAAGACAGCGCGGTGCGTTCCGACGACGCCTTTGGCAACGCAAG
CAGTTGTCCGATGGCAAGTTCCATTGGGTCCGGCAAATAGTACGGATGCGGTTGACCCGCTACCGGAGCTGCAGGGTGGAGATTCAGCGCAGGCGACGCT
ACCGTCGACGGCGGAAGCGACGAGTTTAGCGGGGCCCAACGGAGAGAGCGTCACAGACTACCATAACCTGCGCTCGCAAGGCTTTGTGTCGATGTACGAC
GCTACGGGGCGGCTGACGTGGACCAAAGCCGATGAAGTGTCGATTGACATGGAATCGTTTGGGAAGGGCTTGACAATATTGACTTTGAGGTGGGCAATTG
TGGCGATTCGTGCACGTGTGTACTTGCTTGAGGTGTTCACGGTTGTGCTTGTTTGACTGTAGGGAGTGATGGCACTAAGTTTCCGCATGAAGAAGCAGTG
GTTCTTGGTGCAGCTGTCCCGCATTGCTACCCCAGTGACTGAAGCCGTCGCCAAACTGAGTACGTCTCCATATTGTTGAGTGCCGTGGCTCCTGCAATGA
AGCTAACCTTTTGATTGCCCACACTTGAAGCAGTGACGCGGGAACGGATCATTCAGCAGTCGCTGCAGCTTGCTGAGGCCCCACCTGACGCCCTTCACGC
GTATTTGAAGATTACGTTTGATGGTGAGCCGGGTATCGATGCAGGTGGTCTGCTACGAGAGTGGTTCGGAATCGTCTGCAAACAGATTTTCAGTGAGAAG
ATGGGCCTCTTCGTCCCCACGAAGGGCGAAGACATGAGCTATTGGATTGACCCGCTCTCTGATGAGAAGAACGAAACCCACCTGAAGCTGTTCCGCCTAG
CTGGTATCTTGATCGGCAAGGCGCTTTTTGAGGGTCTTGTGCTTGATGCCCACTTAGCTCTGCCGTTGCTAAAGCACGTGCTTGGTATTCCAATCTCGTT
CTCCGACCTTGAGTTCCTCGACGAAGAGCTGCACCGGAACTGCAAGTGGCTTCGCAGCAACAATCACGTGGAAGCTCTTTGCCTGACGTTTAGTGTGATG
CTTGAAAATGGTACTGAGGTGGATCTCAAGGAAAATGGACGCAACGTCGACGTTACTGACGAGAACAAGGAGGAATACTTACGGTTAGTCCTCGAACACC
GCATGCTGGACAGCATTGCTGACCAGTTGCAAGAGTTCCTCATGGGCATCTACGATGTGGTGCCGAAGGCGCTGCTGTCTGTGTTCGACTACCAGGAGCT
TGAGCTGATCCTTTGCGGCATCCCCACTATCGACACGGCTGACTGGAAGGCGCACACTCACGTGCGCTACATCAAGCCCGAGGAAAACAGAAAAGGCAAC
ATCACCGAAGAAGAGCAGAACGGAGTGCTGCAGTGGTTTTGGATTGTTGTCGAGGGTCTTGCACCCGAGGAACGTGCTCGGCTGTTGCAGTTTGTCACTG
GAACCAGTCGCGTGCCCGTCGAGGGCTTCCGTGGGCTCATGAGCTCCAGCGGTATCATCCACCAGTTCACGATCCAGCTCGTGACGCGGGGCAAGAAGGA
GAAGGCGGACCTGTTCCCCAAAGCGCACACATGCTTCAACGACTCGACTTGCCCATGTACCGCGACATGGAGGAGCTGGAACGAAGCTTGACGATGGTAT
CTCAAATGGAAGTCTTTGGCTTTGGCCTCGAGTAGAGGCAATAACAAAAGTGCTATCCAATATATATGGCAGCAACTCGCGTGTGTAAGCTGTAGTTCTG
AATCATTCAAGTTGCCGTGACTTACAAAAGTGTTCGGAGTTGCGTTATTTAGTCTGGTCCTTCAGCTTGGCAATATGCGCAGCGACATCTTGCTGCAGCA
TCTCCTGATGGCGTTTATCTCTGCGACCTTGAGAGCCGTCCAACGACGAACTTAGCCACGCAGGCGAGGCTGCAGCCTTCTGCTCTCCCGGCTGCTCCTT
CTTCAGAACGGCCAAAGCCGCCTCGATCTTGCTCTCACTTGTAGCCAACTTCATATTTTCTTTTGTTTTATCATCAGCAGCACTTGCAACCGTTGCGGCG
CTCTGTCGACTAGCCATAGCCTCCTCCTCCAGTCGTCGGAGGCGGTTGCGCATTTCCTGGATAGCGGATGCCAGCGCCGATTCCTTGTCCTGCTGCTCCT
GGACGGCATTTATCTCGCTCTCTACCTGCTCCATGCGGAGCGCCTCGTTCTCACGGTCCATCCGTCTCTTCACAGAGTAGAGGTACAAGCCCCAGCACAG
TGCCAGGCCCGAAGGCGAACAAGCCGTAGAAAAGCTTACGTCTCGGAGACAGCAACTTCCTGCGGGGGGCAAACAGCACGGCGACATCAGATACAAAGCA
GTTCTAGTGTTATAGTTGGCGTTTACACACTCAAGCGCGTCCGGAGGCGCGTCCGAGAAGAGCATCTT