Description :
From Genome Similarity Track
Location :
Scaffold_17:29589- 32229
Transcript NameFunction/comments
Phypa_INRA-310PPTG_09029hypothetical protein
Phypa_INRA-310PPTG_09030bifunctional aspartokinase/homoserine dehydrogenase

Sequence
2640 bases(100 bases per row)
CGCGTGCACCGCAATTTCTCGCCAGGAACAGTGTGCTACCAAAAAGAGATCCCGCCGTGATCGAGCAGTCTGCGATGGGACCCGTGACCACCACGGGGTG
TAGCGAATGCCGCAGCGTGTAGAAGGCAAAGCCACCCTGACGGCACTTGAGCGATGCGAAGGAGTGGGTCGGCGGCAGAGCCTCCACCCGCACCGAGATC
TTGCCCGTGGCAGCGTCGATGTATGACATTTGACGCAGCTGCAGTGCCTGTTTCGGGTCTGCTACAGTCTTGGCGATCTGCTGCTTCAACGGCTCGCTGG
CCTTCACGAGGTGCTCCAATAGATAATCGTAGCTCCAGGCTCCGACCTCGTCCTGACTGCCAGCAACCGTGGCGCTGGGATCCCAGGGACTCTCAATGTT
GGCGTCCTTCATCTCGATGTCGTAGCCCATCTCGCGAGCGATCATAATGGCCTTCTTGGCACTACGTACGCCCATGACGTCGTCCACGATATCACGCACG
CTGAACTCGTTCTTGTACTGATCCATAAGGTCCTTCATAATAGCTCCAAGATCAGCCTCCGCCGGCTCCGGTAGTGCGAACACAGCGTCGAAAACAGCGT
GCAAGAAGCGGCTTCCCGAGTATTCCACCCGCTGGATATCGTCGCCTGTCTGGATGAAGTTTTGGATGGTGTTGAAAATGGGCACACCAATAGCCAGCGT
TGCCTCCGGATCGTACGTTAGTTCGTTCTGAATCGCCATCTCCTGCATGGCGTTGTGCTGCTCCGTCGAGGCCGACGACACGTTAATGTTCGACGTCATG
ACGTGCACCTTGCGCGCCAGCCACTGCGGGTACAAGTCCTTGACGTGATGTGAGCTGTTGGAAACGTCAACGATGAGCCAGTGTGGCAAATGGTCTGCGC
AGACGTGATCTAGGAACTTGTTCCGGTCGAACGGCACGAATTCGTCCTGCCGGGCTGCCAAGGCTTCTTCGGTGATGTCACCGTCGACGTCCAGCAGCAT
CTGCGAGGTGATGTGTGTGCCGATAGCACGCACACGGATGTCCACGTTGAAGCGCTGCTTCAGGTACTCGCGTTGCTGATGGTACTGCTTCAGTAGAGCC
ACACCGATGCTGTTGGTCTCGTCTTCATCGAACTCGAGACCCATTAGACCGATGGAAAGGGTCTGGTCCGACAGGAAGAACGACGAGTGTACAGCACGCA
GCGCAGCGGCCGAGTCCTTGTAGTGTACCACAGCCGAGATATTACGCTCCGAGGATCCCTGTGAGATAGCCAACACGTTGATCTTTGCACGGCCTAGAGC
ACCGAAGAAACGGGCGCAGACACCGGGAGTCTGGTTCATCTGATCACCTACAGCAGCAATGATACTGATAGGCGCAATGTACTCGGTCTTGTCGATGTGT
CCGACGTGGATCTCCTTGAAGAAAGTCTCGTTAATCACCTCCTTGGCGACTTCGGCGCAGTCCATGGGCACAGCGAAGCAGATCGAGTGCTCCGAACTGG
CCTGCGCAATGAGCACAACGTTCACCTTGACGCGGTCCAGCGCGCTGAATAGCCGTGAAGACGTGCCGTGCACACCGACCATGCCACTGCCTTCAATGTT
AAACAGTGCCAAGTCATCTACAGTGGAGAATCCGCTCACAATGTTGCGAGCTGTGGGAGTTCCGTTCGACATGGTGCGCTTGAGCTCCACCTTCTTGCGG
TCTGAGATCTTCGTGCCCGGGTGTTCAGGCTCAAATGTATTTCGGATGTAGATAGGAATGTCCTCCACGATGGCAGGCGCCATAGTCTTCGGGTGGATGA
CCTTGGCACCGAAGTACGCAAGCTCCATGGCCTCCTGGTACGAGATCTCGGGCAGAATCTGAGACTCTGGCACACGTCGTGGGTCAGCGCTTAATACACC
GCTCACATCCGTCCAAATCGTGACGCTGCTGGCGTGTAGCACACGACCACAGATCGAGGCTGTGAAGTCGCTACCGTCACGCTTGAGTGTGGTCATGACG
CCCTCGACGGTGCTGCAGATAAAACCAGTGATGACCACGTGCGTGAGCTCATCGCCCTCTCCGTTCTTCAGGATCGCATTAAGCTTCTGTTCTGACAGAT
CGTACTGCACCACCGGACCGTGCTCGTTGTCCGGCTCGACTGTCAGGAAGTCGCGGGCATCCACGAACTGGAAACGGTGTTTTTTGCCGTCGTCCTGCAT
CTTCTGGCTTAGTACAGCTGTGAGGATCTTGGCCGACCAGATCTCACCGTGACCTGAGATGAACTCCACCACGTTCTCGTTGTACGCCTGCATGATGGAG
ATGGAGCGCAGCAGCTCCGAGACGGACTGAAGGTCGCGCTCGATGGCCTTTTCGATGGGCTCACCCACCTCAGCAGGAAGAAGTGTGCTCACCACGTCGT
GGTGTTTCTTACGGAGCGTGGCCAGGATTTCGTCGCATTCGGCCGTGCGGCGCTGCTTGGCCAGTTCGAGCAGCGAGATAAGCAGGTCCGTGACCTTGGG
TTTGCCACCGATGGCCGACACCACCACAGCCATGCGCGGGGCCTCATTACCCGACACGATGTCCGCCACCTTGGCGAAGCAGTCGGCGCTGCCCACGGAC
GTGCCGCCGAATTTGTGCACCACGAACTTGTCTGCCATCG