Description :
From Genome Similarity Track
Location :
Scaffold_323:29583- 34143
Transcript NameFunction/comments
Phymu_g8601hypothetical protein PHYSODRAFT_553035
Phymu_g8602protein kinase, putative

Sequence
4560 bases(100 bases per row)
TTGCCGCCAACCAAAACAACTTGAACGGCACTATATCGGTCGCCATGGCACCAACTGCAGGTGggtcttgctgctcctggGCTCTTGCATCCCTCTTTAA
TGGCTCTACAGCAATATCCACGTGTTTTCTAACCCCTGCACGCTTCTACTCCGGTAGGAACTCGCCTGCGGTTCAAGAACGTgcgctccaagaagacgca
aCAAACCAAGAAGGTCCCGTCGCTCAAGAACCGCATCCGTGGCCTCGAGCGCTTTCTCAGTCGCGGGGTACGTTCGCCACAATTTTGCGCAATAATAATT
TGCAATTTGGTAGGCTAAAGATGGTTGGGTATCGGTAGGGTCTGGCTGATGCCACTCGGAGAGCAAAGAAGgcagagctcgagcagctcaaggaagaGGT
GAGTGGCTTTTTTTCTTGAAGTTAAAATGTAGGCCAAgggctggaagctgaagcggatgCATTGTTCCGATTGTGACAGCATGAGCAAAAGGAGAAGGTT
gtagtggagaagaagaatgccGAGAAGTACAAGAGAGTGAGTTGCTTACGGAGTCGGTTCTTGTTAAATGGACACTAACAAATATTTTTGGTTTTAATTG
TTAGCCGCGCTTTTTCGAGCGTGTCAAGGTCATGCGCAAACTGCGTCAGGTGAAGAACCGCATTGAGCAGGTGAGTGAACGTGGAGTCTGTTGCTGAGGT
TGCCGTTCTGTAGTGTTGAGCGTAATTCTCAATTTGTTGCTACAGGCAACTGACGACGCCGAGCGTGCTCAACACGAGAAGAAGTTTAAGACATACCGCG
AGGAAATGATGTACATCTACTATTACCCGAGAGCTGAGCCGTACCTTGCGCTCTTTCCGTCCGCACCCCACTCAGAAGAGAATCAGAGGCGCCAAAAGGA
GCTTCGCGCAGAAGCTATTGCTTCCTTTGAGAAGGAGCAGCCCACGGAAGCGTTCCACCAGTTTTGCTTCAATGACAGCAAGGCCAAGGATACGAAATCT
ACCAATGAGGCCAGGCCtgctgtggagctgctgctcaagaagccCACAAAGGAGCAGGtaaagaagcagaagaaagcgCGTAGCAAGCGCGATAAGTCAG
GTGAAAAGTCGAAACACACCCCAGCTCTTGTCGAccaagatgacgacgatgaaatGCCTGATGCATCGAAAAGCGAGAGCGAAAaagaggagcaggaaga
ggagcaggaagaggacgactTCTTCCTTTGATTTGGGCTTTAATACGCTGAACTGTTCACTCGCTGTTGTACTTTTGAAGGCCATGGTTCTTGATATTTA
TTACTAATAGTCTTTACGCTGACGAGCTCATATgggaagatgaagaaggttAACTTGGTCACAAAAGAGGCGAAAAGTTGAGAGGTATCTGGAGATCTCA
AGACTCGCTCGACCTAGATCAGGATGGATGGTCCGGCTGGGGTTATTGTTTCCTGCTCCGAGTCAGTTATCAaatctgcttcagcttgcgATGCAGCCGC
AAGAGCGTTCATGTTTGTAAAGCTGAAAGACCTGAAGGCATCTGAAAGGTTGGAATCGTCGGGGCTACCATACATGCCACTAGGGAACCGAAAGTGACTG
TTGTTGTCCTCCATCTGCACACCATCACCCATGTACTCGTCATCACGAGAAGCGCTCTCCAGTGCACCTAGAGCCCCTGCGGTCCCCCACGACGAGTCTG
GCGCACCTAAAGTCCCTGCTGCCCCCCACGACATGTCAACATCCGAGATGGAGACCGAACTGCTGTTTGCATTGTTGTTCTCCGCGTCATTATCATCCTC
TCCTTTCGGGTCAGATGAACTTATCGACTGGGCATCGCTCTCAGGTCCAGAATCAACGTTCTGGCTGCTACTTGCGGAACGGGTAGTAACGTCAAACTCA
TCGTCATCAATGAAAATGTCGGTAAGATTCCGGTTGTTGAAATAACTGGTATCGTTGGGTCCCTCAAGAGTCGGCACAAACGGAGGCACGGAGTCCAAGA
TCGTGTCCCAGTTGATACCATTGAAGAAAGGATGCAGCTTGATATCCTCCCAGCCCATACGAGTCGCCGGGTTCGCGTCAAGCAGCTTGTCTATCAAATC
CACTGCCTCAAGTGACAAGCACTTCTCACCGTCAGGCCATAAAATTTGCCGCGCTATAATGTTTTCGAAGATTGCGTCGACAGAGTCATCATTAAAGGGC
GGAAAGCCAACCAGCATTTCATACAAGATGATCCCAAGTGCCCAATAGTCCACAGGGGGGCCATGAGGAGCACCGAGAATGATTTCAGGAGCCAGATAGT
CAGGGGTTCCGCATCGTCCAAACGTTTGGTACACAGACTTCTTtttcgagctccttgagaCTCGCCGCGGACGGGTAGGTGGGAAAGCAGATGATGCATC
TCCCAGAGGTGTGCCAAGCAGGTTTTCTGGGTCCTGTTGGGCCATGGACTCGTCATCGGGTTCTGAATCGGTGTCACTAACAGCTACAGCTTCCTCGGAC
AAGCCGAAATCCGTCAGCTACGGGGTAAAAATACGGTGATTAAGATCAGAATCGAGACGTTAGGAATCATAAAGCAGTCAAGCGCACCTTAATGTGCCCG
GTTGAGGAAAGCAAAATATTGTCTGGCTTCAGATCTCTGCAAATTGTATATCAAAGGTTAGACGGAGGGTTGGATGGGTTTGCTGTTCAAGCAATGCAAC
CGAAACGAGTTAAAGAACAATCCGGACCTGTGAACGCAGTTCTTGGTATGCAGGTGATTGAGTGCGATTGCGATCTCAGCGATATAAACGCATGCCACCT
AGAATACAATACATAAGTTATGGATAAAAGTAATCAACAAGTCAAGCAGTTGCACATGCCAGCTAACCTGTTCTTCCAGCTGAACAATGCACTCGAGCAA
CGACATGAAATCACCACCAGGAAGATACTCCATCGCCAAAAAGAGATTGCGCCTATCCACAACAAAATAAAAGCCCTCAAGTATAAGTCGCTGTTCTCGA
CATGGAAGCTAACTGTGATAGCATGCTTACTTGGTTTGGAACGTCCAGAACAGCTTCACAACGAAAGGGCTGACCACATTGGCCAGAATATTTCTCTCCG
TCTCAATCTGCTCGATCTGCAGGGGCACACAACGGAGCAAGTGCTCAGTACAACCATTGCTACGATTGCGAACACAATATGCAGCAGACAGGACCCTGTA
CCTGCTTTTTGCGCAGTAAGTGCTCTTTTGCAAGCACCTTAATCGCATACTGGTCGCCTGTCGTCTTCTTTCGTGCCAGATACACCTTTCCGAACGCCCC
TTTTGAGATCGGTTTGACGATATGGAAATCACGAATAGAAACACGATAGGAAACTGGCTTCAAGCTCGACCGTCGTGGTGCACGACGCCCCTCGATATTT
TCTATGTCCTCCAGCGATTTGGTGCGCTTCAGCGGCAATCGTACCACCTCAAGAGGAGACTGTTGGACCAACATTACCTTGTGAGATGCACGCATTTTAC
TCATCTTGGCATGGATCAAGTTGCGTAGCTGCGAGCAGTACTTGGCACCACGTTCAACGGCAAAGCTGGACGTTTCCACTTCCTGTTGTCGTATTCTGTC
GATGATTTTCACTAGTCGGGCACAAAGTGCGAACGAATCCACACTGGTTACATCACAAGTCGAAGCTTGGATCGCCACGACACGCAGTGCATGATAGATG
TGCATCTCCTCCTGATCAAATATAGACGACATCATCTCCGTTGCGAGCGTGGCGTTGATCGACGCTGTGAGCTTCACCAGCGAGTTGTTAATGCCGTctg
cttccagctccactctCTTGGACAGCACACAGAAATTGGTGTGGTCGTCCAACTGGTTGGCGTCCACTTTCGTTTCACAGAGTTTACACACGACCACGGC
CTTGTTTGTGTGTCGGAACGTCACAGTCATGGGTCTCTTACTGAACTGTAGGTTATCCAGCACGTCTTCGGGCGACATAGCATCCACAGCTCGTCCGTTC
ACAGCCTCCACCGCCATCCCTTTGGTAACAGTAACTCCTGGCGGGATATTGATGGCCACAGTGGCCCACGCCTCCGTGTGGACGCTCTTGATCACGACTT
TGCTCTTTACTGCGTCGAACACGAACTCCAGTCCGAGGAAGCCATCTCCAAAGGTCATATCGAAAGTCTCTGTCTTCTGGACGTCCTCAAACAAatctcc
accgtcttccaGACTGGGTCCAGCCTGGTCTGCGTCttggttctcgtcgtcggacGCCAAGTGACGCCATTTGACGCGGTTCTTCTCCCACCGGGTCAGT
ACGTCCTCCAGAGCGTCCGGGGGTGCGTCCAGCAGCCCTGGCCGCGTGATGGAGGCTACACTGGCACTGAATGGCGGTACATTGAGCGTGTACTGGCGTT
GCAGACGCTGGGGCTTGATCTCCAGCTTAAGCTCTTCGTGCAGACGCTCcatttcgctgctgctggtgctgctgttgctcgtgcgGCGGCCGCTGCGGTC
CGTGgggagctccagctctgccaCGCGGGCCAGGGCGAGCTGCTGGGGCCGCTCGGCCAT