Description :
From Genome Similarity Track
Location :
Scaffold_43:295783- 298329
Transcript NameFunction/comments
Phyin_T30-4PITG_16178Putative uncharacterized protein

Sequence
2546 bases(100 bases per row)
ATCTGCCGGAGCTTCGAACTCTAACAAGCGACCTCGTACCGACTCGGACGAGACTGGACCGGAGTTTAAGCGACCTCGGCCCAGGGATCCTTTCGACCCA
GTCAAGCTTATTGTAGCTAGGTTTGGTGAGGTGGCATTAAAAGTCAAAATGTTGGTCTCAAGTGGGAACGAAGTTACCAACAGAGCACAAGAAATGGGGA
GCGCTGTGGGTGAAATGAAGGTAGCTGCGACAGCCGCGATCAACGGAGTCACTGAGCTGCTCGAGCATCCAGACTACCATGGCCAAGACATTGTGACGCA
GCAGCGCTGGAATGGACATCATGACGAGTTTTCTGTCGCGTATTCCTGCGCAGAATCTCAGGTTTGCGTGGTTGCAGCGCACCACATACGAGTTGATGTA
TATACTGAATCTTGGTAGCAGCCAGGGGTTAGCAGTGCAGCTCCAGTCGTTGGCGACGAGCTTTACGAAGGTGGAAGCTTACACGGAGGACAACATTTAT
GAGTTCGAAAGAGAACCCGTTCCTACTCTCGATGTGATGGAGAGCCGCGTCAAACGCTTTCGGCAACTGAAAAAGAAGAACATGATGAGTCCGATACAGT
CCATTTCAGGCGGATTACTCATTGATATCAGCTACTTTAGTGCTCAGAATGTGGATAAAAAAGTGGTGCGCTCTGTAGAGAATTGGTCTCGCTTCACGGC
GGTGGGAAAAGCCCTCGCCGCTTGGATGCATCGGGCTCTCAAGTCAAAAGCACGACTGCCGCATAACTTTTTCAAAAGATTATCAGAGCAGCTACAGGAG
TTCGACGCGAAATTCCCAGACAAGTTGTCGCCCTACTTGTTGAGGTACGCTTGTTTGAATTTCTACATTGTAACGCCTTGTGTGATGTTTAAACAATTTT
ATAATGCAAAAGGAATACTAAAACTTTAGCTACATGGCCACAAAAAGTCTAACGGAGGCCAACACAGTAAAAAACTAAACGTATCGGGTTCCAAAAAGTA
TAGCAAACAAAACACAGAAAGATCTCAGTACTCTTCCATCCGGTATTTTATTTTGCTGCGAGTATCATGGTTCCTGAGCGAAGTTACACAGCGTCGGCAA
ATAAACCAGACCTTACGACCAGCCTTCTTTCTTGATCTTAGCACCTCTCAGTTTCTGAACTTTGAGCTCATGCTGCCATCTTGTCGCGATTTTCGCCGTT
GCAGGCACGTCGCTTTCTCGAGCATCGCGGACACGTCTTGGAATTTGTAGAACTTCGTGATCGTGTGCATCGTCGTAGTTGCGTCAACACCTCGTTTCGA
GTTAAACATGACTCTGTAGCTTTGCCACATCATCAAGTTAGGATCGGTCAGAAGCCTATCCAGCCCCTTATTCAGCTGAAGTAGCTCGAAAACCTTATCA
GGGGATATATCATTGTCAAGCCACTTGCTCACCATTCTGTTCTCCAATTTCATCGGAAGACGCCCCAAGAGATCTATCCTAGGTTCGCCAAGTATGAAAA
TCTTCGAGAGCCCAGCGTAACCATACTTCCCTATCAATGTTCGAAGCATGCGGTCTTCTATCCCCCACGCCATGTCCTTTTTTAAAAAGGCATAGAAAGT
ATTTACCAGCGGTGATCTGAACAGATCAAATCCCGCCTTGTCGAGCTTTAAAAGCTCAAAAACAGCGTCGGGGGATTCTGCATTGTCGACCCACTTTTTC
ACGAGCTCCTGCTGCAGTCTTGACGCAATTTTTCTCGTCTCCATATTTAAGGATTTCTTTCCCATTTCTATCATTTTGGCGGCGCCGTCGTCTTTATACG
TGTTGCTGAACATGTCGATCATTGCCGCTTGCTTCCTGGGATTTTTCTTGTTGAACCGGTCGATATAGGCTGCGTAAAGGTGGAGCTTCGGGCTTCGGGT
TGGTGAATACCTTATCGAGTCCGCCATGTAGGCCCAGTTTCTGAAAAACATAATCCGAGCTCTTCTGGTTGTAAATCCACTTTCCGACTGTGACCTTCTC
AGCTAAAGTGAGTTCTTTTGCAGCTGGTCTAGAAAGCCACTGGATGAACTTTGACATTGTGGGATAGCTTATCGCTCTTTCTTCGCCGCTGTGTACTGTG
TCAATTCCTCGCCATGAGCTATCTGAAAGTTTACCATTGCGCTCGTAGTCGATATGGCTGCGATGAGGGCCACAATAGCGAGCAATACCAGACAGAATCG
CATGCTCGTGCGTCAGAGAGTAAATGTTAGAGGAGAGAAAGACGTCCGACAGAGGGGAGGGAAACTGTAAACTGTTGTTTGCTTCACTACTTTTTCGCGA
TATACAGTTTCGTCAAGGGATCTGCTCAGTACGTGTGACTTTTTAACAAGTTAATTGAGATTAAAGCTGGAGAACATCTTGCAAGATGTATTGAGTCCTT
TTTATAAATTTAGCGGTCAATTTTTGCAATGTCGCTGATTAGTTATCGACTAAATCAATAAATAACTGGCACTAAACAAAAGGCCTCAAGTCCAAAAAAA
GAGCCAAACTTTTGAAAGTATCACGGGAGTTTTGTTGCTGCTGCTC