Description :
From Genome Similarity Track
Location :
contig_15:29578- 30780
Transcript NameFunction/comments
g4142.t1RAW24142.1 hypothetical protein PC110_g19429, partial [Phytophthora cactorum

Sequence
1202 bases(100 bases per row)
CCGTCGTCTCTTCATCTTGAATGACCACCACCTCCCTCTGATGGTAGTCGCGTCTCCCACTGTCGAAGACGTCTTCCATGAACTGCGCGTCGCGGCTCAC
CAGCACGCGACTGCTCTCCAGTTCTTCGAATCGATACGCTTTCTCGTGCTCCGAGTACCCCAGGAACCGACAGCGCACTGACCGAGCGTCGAACTTGGTG
CGCTTCGCCTTCGGCACGTGCACATACGCGTGGCAACCGAAGACCTTGAGATTGGCCAGCAGCGGCTTCTTGCCCGTCCAAACTTGGTGCGGAGACTTGT
CGTGGCTGATGGCGCGTGTCGGACACCGATTACGGAGGAACGTAGCCGTCATCACCGCTTCACCCCAATACGTCTTGGGCAATCCGGCATGTTCCAGCAT
GCAGCGCGCACACTCCACCAACGTCCGGTTCATCCGCTCGGCGACTCCGTTTAGCTGAGGCGTGTACGGCGGAGTGAACTTCTGCACGATACCGCGGTCC
GCACAGAACTTGGCCATCGCACCGGAGGTGTACTCGCCACCGTTGTCGCTCCGGAGTGTCTTCACACGCTTGCCGGTCTGAGTTTCAGCAAACGCCACAA
ACTCCGCGAACTTGGCAGCCACCTCGGACTTGTTCCTCAGCAAGTACACCATGCAGAAGTGCGACTTGTCGTCGATGAACGTGACGAAGTAGCGCTTGCC
CCCAAACGTTGGCGTCTGCATGGGGCCGCACACATCGCTGTGAACCACCTCCAGCACTTGCTTCGCACGGTTCGGGGACGACTTCATGTAGCTCACTCGC
GTTTGCTTGCCGAGTGCACACCCGTCGCACAGCTCCCACTGCTTCACCGACGTCATGTCGATGCCAACACCGTAGCTCTTCTTGACGATGGCGTCTAGAC
CGCCATGGCCAATGTGACCAAGTCGGAGGTGCCAGAGGTACGACGTGGTGTCCCCTTGGCGATCCTTCGAACTTGCCGCATTGGCCTCGTCAGGCATCAT
CGGAGTCATGCACAGCTTGAACAGCCCTTTGCCCTCACGAGCGCCGAGCTGCCACTTGAGACCCTTGTTGTCCGCGAAGCACCCGTCGCTCTCGAAGGTC
ACTGGCCCGACGTCCTTGGTGAAGCGGCCGACCGTAAACAGGTTGCGCGACAGCTTCGGGATATGCCACACATTCGTGAGCACCCCCTTCTTCATGCCGC
GC