Description :
From Genome Similarity Track
Location :
scaffold_1:295738- 297571
Sequence
1833 bases(100 bases per row)
ttgaaactgtgtttatctgttttatttgcggcagagccacccATATCTGAaacttaggttttcctgattaaatagtaaaatctaattaatatgcataagt
aCTGGCGGTTCAGccatgtagtggcttcttgctaaggtgtagccacacctttgtgtgatgacaccgacttgtgaatTCCACTCCTTTGTATGCCACCCtg
tcataccagggtacgtgtaactccgttacagtGTTTGTGTTCTTGGTCGTGCGATCCTGTAACTGGCAATGCGCTGCGTGTTACTCGATTATCTAGAGCT
TGAGCCGTGCTTCCTTTGAAGCCGCAGACTTGCtatccgaagttgcaccgcgtgcaggagacgatgaagggctctgcccgcggacgttctcggaaccagc
gtcTTCCGTCTTATAGGCACAGGGATCGATTAGCAAAAAATTCGTCAAGGaggtcctggtgatgttgtggtttCATAGACACGTAAGCttcagttgaatg
tgaactgtaattgctcacaatcttgatgggggagagtgtaaagGGTCTCACATGCCCtagtatgaagggtgtgggacacacaagatggtgcgatcacaag
atggtgcgggATACAAGTATGGTGTGAGCACAAAATGGTGCGGCTACACCAAAACTAGAAATCAGTactggctggaacagccagtaattatacatttaat
tagggtTTACTACTAAGATTTTGataaaggcggctttgccataaataaaaccaagaaatacagtttacgttctaaacggaagatttaattagccttgcgT
TAAGGTTGTTATTACCTTtgaagtaagtggattgcgatccgctacactcgtactggttctaagcatagaacgaaggtcaccgaccctgaccaagctttct
ctaagcaaaagagctacggcagcctcgctgtacTGAACATTGCCGACTCCAGTCGGAAAATCCATATCAACATTTGCTATCAGCACGCACTGTTGAGAGG
AATAGTATCggcatccagctgctccaTTTGACTGTCGAATTTGGCACACACTGCATGTTCCATTCGGACCGAGCTCATGTTGACAGCTGGTAGATAAGTA
TCGAAGTCATCAAATTTGAGCGAAAACCATTGCGACAAGTCATGATTTTTATCACACGGCAAATTCAATATGATCAAGCTTTATGGCAAAGTCACATCAT
AATTGAATTCTGCATCTATCCTTTTCTCGTGGCTTTATTGTCCACGTTTGGTGCTACCCATGGCAGCAAAGCTCACCCCTTATGATTTCACGGCACTTGA
CTGCTTCATCACTTTCCAGTGCTTGGCATATGTTGTCGGCAAGTCCGTATCATCGTCACATCTCGTCGCGCGGACAGGAATAGTATTTACATTAAACCCG
CGATCTTTAATATAGAACGCTTAGGAGTCAATCAGTCGTCGCTTTCGTCTGTAGACTCTTCAAATCCAATACGCTCCTTTGCATCAATATCGGCTCATGT
CTTCGTCTTGCTCGCTACACTTTAGGCCAAAACACCAAACGATCGTGTTGTAATATTTGAAGCGGTGAGCGCTACTTTACTAGCTCCATCTGCTTCCAAG
AGTGCGCTTTAAAGTCAGCAGCAGTAAGTTGACGCTTGGTGTTTGCTCAACATCGTTATTTCGAAGTCTGATTGGTTAGTTGACAGTTTCCATATGCTCA
TTTACATCTTACTGTCGATACACTTGGTTCTGAGCTCCGATTTAAACATCGTCTTCTTAGTTTTTTAGTCGATTGCAGTAGAAACGCTTTTTTGTAGTAA
TTGCCGTCAACCTCAAGCTTGACCAGCCTAGCG