Description :
From Genome Similarity Track
Location :
Scaffold_233:29569- 31641
Sequence
2072 bases(100 bases per row)
CGAGCATGGTAGTATTGTCGTGCCACCGACACTCCTAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTTGATCTGC
CCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTT
GACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAAGTCCGATATAGCTGAGATCCGTACCCTCTGGATCATG
GACGATCCACCTGCCCCGGCTGTGGCCGTTGCTACCACGGCTGCCGAAGTGGATGGGCCATCCAGATCGTCTGGGTCGAACTCATCATGGGAGTTGTCCC
CCTCTACTGACTCCATCTCCACGTCCCGTGCTCCATGTTCATGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGACCAGGAAGCGATT
CATCGCAGCTTCAAAGTGCCGTTGCAGGGTGCCCGCGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGGGACTGGATCCGTGAGGCGATTA
CCTCGAGCCTGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAAATCACGCGTAGGGCGTACTGGATCCC
GAGCTTTCACGTTCACAGGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGA
CGGCGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTTGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCATAGTACGCGACCTTTCT
CCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATATTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCTTCGAACACACCAGCTA
CGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGAT
CTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAATCGCGTAGAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTT
GACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTTGTTTCTTCGACTAGCG
GGCTTGGGCTTAGGTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGC
GTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTC
CTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTT
GAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTG
CCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCG
GTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGA
AAATCTTCACTCTGCGTCCGTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTG
TGTTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGA