Description :
From Genome Similarity Track
Location :
contig_47:295667- 303623
Transcript NameFunction/comments
g9693.t1hypothetical protein
g9694.t1hypothetical protein

Sequence
7956 bases(100 bases per row)
TTCCTATCACGCAACTAGCTCGTCGCTGCTCTGCTGCAGGTAGCACTTCAACTACCCACTGAGTAGTTGAGCAGCGACGGATCGATCTTCTGGCCCTTGG
TGCGGCGCTTGCCCCGCTTGTTGGAGGAACCAGTCTCAGACGCGCGCTGCTGGGCGTCCTGGTGCCCTGGCGACTTCTTGCCGCTGTGCTGCGTTTTCTT
GCGCTGGATAAACTCAGTCGCAAACGCCGACACGCGCGGTGTTGAGCCCAAATATGCCGCGAGATACTCGCGGATCTCGCCGGGATCCTCGACTGACGCA
CAGTATTCCAACAGCGTCACGTTCGCGTTACTATCAATGGTCGTCAGCTGCTTCATGGCCCACATCATAAACTCGGACGACACATTGTTTGAACCAAACG
CATTTGACGTGCCCACTTGCACGCTACCAGACGCTCCTGCCGACTCCTTATCAGCCGGCTGAGCAACCCCGAAGTTCCAGAACGATGCATCGCTTTCAGC
CTTCGGCGGCGATGGTCTAGCAGCACCGTTCACAGCACGAACCTGCTGGCGGCTCTTCAGCACAGACGCAGGCACAGGGCCTAATACTGACCGCGACGGC
TTGGGGATTGCTGCTGCAGCAACCTTGTTACCCGCCACAATGTTCATCCAGTGCGAGCTGGTCGGCACATTCTCGTTAGCCTTAGCCCGTTCCTGCGCCA
GACGTTCTTCTTCTGCCAGAATGTCACGCATCGACTTTGAGTTGGAGCGTTTAGGCACAACGGCAGGGGCACCCCACGGACTTGCTGCAGGTGCAGCAGG
CGCCGGAGTTGGGGCTGACGGTGATTTAGCTGCTGGGGCCGGGGCCGAAGGACTGCTTGGTGCCACAGCCATCGAGTCCACGCCCAGCATCATCTTCAAT
TGTGCTCCCATCTGCGCAAGATTCGAGGAGCCGGACTGCTCGTCGTCCATCTTGCTGAGCATTTCGCGCTGCTCTTCCTGCTGGATATCCTTCAGCGACT
TCGATGCATTAGAGGCAGTAGTGGATGCCATCTTGGTGGCCCACGCATTTGTCTCACTCTTAGCGTTTTCTCCTTTCTTTCCGTTCTTTTTAGGCGGGCT
AGTGGTTGCCATCTTCTCGCCTTCCCTGTCAGTCTCGTCATCCTTTGCACTTGTCTTCACAGGTGATGCAGCCTTGCGCTGTTCTTGCTGTGTGCCAGCT
TGCTCACCATTTCCGCCAAGCGACTCGCGAACTTCATTAACAGCACGGCGCTTTTCATCATTCTGAATGTCATGAAGCGTTGGCGTTGGGTGCTCAGGAG
AAGTCGGGCGACCACCCCAAGCATCGACCACAGGGACCGCAGCTGGACTTTTTGGCGCGGGAGGTTGAGTGGGTTCTAGTGCCATCGGACTGGCTGGTCG
CGCACCCAGCGCGCTGGTGGCGTTGTCCAAGCTAGACAATTCCGGTGCGGCATTTGGCCAAAACGCCTGGTCGCGCCTCTGCACTTCGTTATTCAAGAAC
ATCGCATCTTGACCGAGAGGCTGCGGGTTCTGCATGTTAAGCTGATGCTGTGTACGATAGTCGGATTGAAACTGAATCTGCATACCGTCTGACCGGAAGC
TGTCGTTTGCCGAGTTATTGTTGCTCTGGTTTCCTCCAAATATGCCAAGCGCACTCATAATGCCTTCACGCTGGCTGCGTTGCCACGAACTTTGCTGCTG
CAGAAGCATTTGCTGTTGTTGTTGCTGCTGCTGCTGCTGCTGCAGTTGCTGCTCTTGTTGATGTTGAAGCATCTGTTGCTGCTGATACAACTGGTTTTGC
TGTTGTTGACGTGCTATCTCAAGGCGCTGCATTTCCATGCGGATCTTCTCTTCTTGGAGCATTCGCTGCTGTTGCTGCTGCTGTAACTGCATCATCTGCT
CCTGTTGCTGTTGTTGTTGTTGACGCTGCAGCTCCAACAGACGTTGCTGCTCATTCTGGCGAAGGTCAACGTGCATACCTCCAACTCCGCCCACACGCGT
TGGCGGGGAAGCGAAAGGCACCTCTCCGTGGACAAACTGATTCGCGAGGGCCCCAAAAGTGCCTTCTCGCCCGAAACGGATTGGAAGGTGCGGCTTGAAG
TAACCCGCCTCGAACCACTCGCGCATGTCCGCTGTTTTGAACGGTCCCTGCTGCAATCCCTGAGGATCCAAGTAAAACCACTCGTCTTCCACTTCCAGAC
GCAACGACGAAAGGCCCGGGAATCCCTCCTGGGGCTGCAGTGGTGAAAGCGAAAAACTACTCTTCTCCTCTAACGCGAGCTGCTCGCGAGCAGGTTCCAG
CGCATCGAACAAGTGTCCACCACTTGACTGGCGACCCAACAAATCTGCCGTGTGATCTTCCACTGGACCATTGGCACCGTTCGCGCTGTGTTGCTCCTCG
GGAGCAGAGTCCTCCCACTGCACGTCTTCATTATCACTGTCATCAAATTGCCCAGCAGCCGCAGCGTCCTCCAGTTTCTGGTCAAAAGCATCCAAATCAT
CTTTGATCTCGTCCTGCCAAGCAGTACACCGTCAGTTCTTCGCTCATACGCACCTAATTCGTCGGGGCTTGGGCTTACCGGGTCGACCTTCGGTCCCTGG
AGCTCCTCTCGCATCGCATTCATCTCTCGTCGGAACTTCTCTGCGGCTTCAGCCATACTAGACAGGTCCTGTACCACAAAACACAACAAACAGCAGAGTA
AGCCATCCCCAGCTCCTTCAATATCACAATACAGGGACGCACCATTTCATTGTTATCCGTTCCAGGCTCCAGCACGTCGTCCCACACATCGTCTCCAGCG
CGAGAACTCTCAGTGACCCTAGCGCCGCGCTCCCACGTTGAGTCTCGCTCATTGTGTCGGTGGTCGTCCCTCTGCTGCTTGGGGGCCTCGTTCTCCTCTC
CACGAGCTCCGCGTTCCTGGTGTCCGCGCGCGTTCTGGGCTCCTCCAGCGGACGCGTTACCGCGTCCACGTCCCCGACCGCGGTTACGATTAAGCGACCA
CTGCTTGTAGATCTCCTCGTAGTCGAAGGGCAACGTGCTCACGGGCGGCAGACTGTGCTCGGACGCCACCGACGTGTCCGGTGGGAACGCGGGCGCCTCC
GACGTTGTGAAATGCAGCGCCAGCAGCTCCTCCTTGGAGTAGCGCAGCACTTTGTTCTTGCGTCGGTGCTCGTCTGCTGCTCCTGCGGCTGCGTCTTTAA
AGGACGCGGGTCCGCCTGACGCCGAGGACGATACGAAACCCTCGCCGTCCTTGGACCACTGCGGACGGTAGGCGGATCCCTCGGACTCGGTGCGGCCGCG
GCCCTTCATGGCGAACATTGTGCGCGGTCGCAGCGAAATGTTGCTGCTGCTGTTGCTGGCTCCGTCTGCGCTGGTGCCCGTGGGGGGCTTCTTAGCCGCG
TCCTGCTGCTGTTTCTTGCGGTGCTTGGTGGTCTTGGTGACGAAGTCGTCGTCATGGCTGGGGCTGCTGCTGCTCATGGCTGCGGCCGGTGCGCGCTTGG
CTCTCGGTTGTTGGTCGCTCCTCTTTCTTTTTGTGTGGGGGGAGCTGCGCGAGGCGGTGCTAGTTCGGCTAAGTACGAATAAAGATTTGAGTGTGCGTCA
CAATTTACAATTTTCGTACTGTGCCATGAGCGGCGCTGGGCTGCGCAATTGGCGGTGCGTTCTCTGCGTGTGTAGGAAATGTTAGAACTGTTTGTGAGTG
GCACGTGCGATTTTAATGCTGTGTGGACTTCTGGTTGAACGCTCGGCGTCTGATTCCATTGCAGCGGCGAGATCGTCGAGGCTAAAGCTACTCCGAGTGC
TGGCGACAGAGATAAGGGCGGCTATGAAGCAGATGCGGTCGGTTCTCGGTCTGCAGCACCAGTCACGCCATTACCGCTGAACGCTCGAGATCTAGCGTCG
GAAGAGCGACGTCCCTCGCAGCAGAAGGTGCTGCGAAAAGACGAGTTCGGTCGTGACGTGGAGGTCGTGGTCGACGAGAAGCGTCGCAAGAAGTCCGAGG
GTGAGCGGATGGAGGACAGAAAGAAGGAAAAGAAACACAAGCATAAGCACAAGAGCCGCAAGCATTGCCGCAGTAGGAGATCGAAATCGCCGAGTGCGCA
GGGTCAATTTGTTGGGACACCACCGCCGCCAGATCCGTTCCGTCCTCAGGTACGTGCTGCACCTGTGACTGTGCTGGTGCTGATCAACTGGAATGACTAA
TTGGCATTGATGCGGCGTCTTATTAGCTTGATGAAACACGATATGGACGCTCGCAGCGACACCAGCGAGAGAGGAGTCTTGGTCGAAGTCGCAGCCGTAG
CCGGCACCACGCACACCGCCGCACTCGAAGCCGAAGTCGAAGTCCCCACGCCAGAAACCACAGTCGCCACCGCCGCCGAAGCTCTTCGCGAAGTCGTAGC
AGAAGCCGAGCCCGAAGTCGAAGCCCACCCTCTCGGTCTCGTCGCCGGCGCTCGTCGGCCTCCGTGGAGCGCAGGTGGACACATAACGCCTTCGACGGTC
GCAGCCCAAGCCCACCACGACAAGTTGATCCACTCTATCGTCCTGATCCTGAGGCCTGGGTATCACGTGCAGGGGGTATCTACTTGCCTCGCAAATAGCT
TCATCTCTCGGAAGCGTCGTTCCAGTTTTCGCGTCGACTGAAGGCAGTAAATGAGTACGCTCCTCCGGGACTGGGATGAAGGTGTGCAAGCTTGATGTTT
AGCTCTTGTGGAATGATACGCATTGCTTCGAGTTGCCTGGTTCGACGACCATTGACTTCGCCGTCCTCCCTGTTCCTCTTTCAGGCTCAAAGAGCAAGCG
CAAAAAGCTTCTTGAATGGTTTTGCAGTCGTTTTGACCAGACACAAGACGGTGGCGGTTTGCTTGAGAGTGAGTGTGGCGCAGATATTGCTCTCTTCTTG
CCGCGCCTCTTATCATGGATGCAGAAAACGACCGTGACTGCAATTGAAAGGACTAACGATAGCTGCGGTGCCGCGACAAAGCCAGAAAAAGTGAAATGTT
TTGCCCTCGGTGAGCAAGTGGCTTGCCTGAATATATTTTTCGGGGCTGCAAATGCGCATGCATATTATCGTGAATTTCAGCACGCGGATGGTCTTCAATT
GGTGCTAAAAATCGCGGCCTTGCAAGGCAATGATCCCCAAACGCAGAAACCACTTGTGCCAACCACCAACCGAGAAACCTTATTTCGCATCATCCTACGG
ATCTCTAAGATGAGTCGACAGTGCAAAGAGGAAATCAGTTCTCTTGATGGCGAGTTAGCTGTGATTCATGGGATTTTAGCCAGCGGTGACATTGATGATT
GGAAAGTTGAGTCTCGTGTGTGGACTCTTTGTCGAGAGGTTCTGCTTGAACAGCTCGTAGGCAACCCCAACAGTCTTGACCGAGCCCACGAGGCGATTGT
GTTTATGCTGAATCACTCAGAAGTGCGCCTTCAGCTCTTTGGGGCACAGGTACATAGGCTTAGTGTCGCTTGCTCCTGCATCAATTGGGGCTCAGTATGT
TGGGTATCGTTTCTTTATGGCACGTCGGTGCTAGGTTCTCCGAGAGTTGATCACAGAAGGATCATTTTCGTATGATCCAGAGTATCGTCGCCGAAAGGAG
TACGATCTTGTGCCTCTGAGCCTGATCCTCTTCAATTCGACTGACGTATATCTTCAACATGAGAGCCTCGAGCTTCTTCACGCTCTTCTACAGTCGAAGC
ACTTGCAGGTTGAACGTTTATAATCCGCAACGTCTTCTTGAGGAAATTAACGCGTTTGAGTGGCTGTAAAAGGATCTCATTTGCGAGAAGCTCGTTTGCT
TGGTTGGCGACAGCGCCAAGACCCTTGATGTGTATGATTTTGCCTCCGTTCTGCTTATTATTTGAGGCCCCACTTACGAGTTTTATACTGGTGCTCTGAT
TCCAGCAAAGTTGAAGAGCGCTTCGTCTCGATCGAAGACACTACAGAGTACGAAACCTATGCTCATCTCCGTTCATATTTTGCCCGTGTATCCCAAGCCG
TCAACACTTTGATGCACTCAAACCGGAACTTGCTGCCGATTTTGGTACGTTCATACTTCGAAGTACCGGTCCTTTTGTAAGCTAATTGCATGTGCAGGTT
GATCGGCACGGTCTACTCACACCTCTGGCATTCTTGCTCGTTGTTGAGCGACCTCACTCACTGAAGTGGCATGCTGCTGCCATAAGCATTCGATACATCT
TTTCTCACCATTACCAGGTAATGAATGAGCAGCTTTACTGACAGGCATTTGCGCTCGCTTGTATTGACCACTTGAGATGCCGTTCATGATGATGTTAGGC
AGCAGCTGTGTGCCTCGCCGAGCTCTTCGAGGTCCCAATGGCTGAGCTGCTCGTGTGGAAGGATATACGTGGCGATGATGGCGAACAGCTCGCCGAATTC
CTCTTGGGCGACGATGCTCATCAAAGCCATCTTGCGCTCTGGTTTTATCAGCGTGGATGGTACCGCCCGCTATCTCCGAGAAAGCAGTCCGAACAGACCG
GAGCTGATCGTGCCCTCAACGACGTCGAGCACAGTGTTGAAACAGCGGCTCGAGACTACGTTCCAGAGGTAGTATCTTGCAACAACAGCATTCTTTAATC
CGTTCCGCTCACTCCCTTCGTGTTGATACAGCTGCAAGTGCAAACGCGAGTGGGTGAAAACGCTGACGACGCCGAGGAAATGGACATCCTAGAGGCCCAA
CGCGACACCACCTGCGTATCCAGCTACAAAAGCATTTCGCCCAATTCCGATACGTATCAGCAGCGACTGCAAGTAGCGACAGTTGCAAGTAGACACACAA
GCTAGCAATCGACGTGAAATTAATACTACTGGGGCCTCCGACCCTTTCCGCCAAGGTCTTCTTAGCTCTCCTCGGGCGTGTAGTGGTCCTCCAGGAAGCG
TGAGAGCGTCTGCAGCTGCTCTGACACGACCTTGACCTTCTCGCGGCTGATCTCAACGTCCTTCTCGGCGCCGTACGTGCTGCGCGCGAAGGTGCGGTAG
TCCGAGACGAGGTGGATGTGGTTGGCCAGCTCTGTGTGGATCTCCTTCACGAGCTGCAGGAACTCGGTGCACGCCGAGTTGAAGGCCAGCGACGAGCTCT
CCTCGGACGACACGCGTGGCGCCATGAGCGACATGGCGGTGGCAGCCGTGCGCAGCGCTGTCACCAATTTCTGAGCGGCAGAAGCAGTACAAGGTCAGTC
GGGATTTTACGCGCAAAAAGCAGCAAGTGAAGACGGACTTTTCAGGCAGCAGCCTCACCTTTTCGACGGAGTCGAGTGTCTGTAGTACCTCGACATGCCG
CGAGCTGGACCACGGGTCGCTCACCTCGGAGAAGTGCACGCGACTGTCGCCCTCGCCCTCCATGCTTGTGCTGTGGGGAGTGCGAGCAATCCCCTCAAAT
GCGTTTTATCCGTTTGGACAGGCTATACCCGTTATACCCGATAGTCTCCATGCATCGATTTCAAGAGTGGAGATCGACTAAAGCGAGCCGCCTCTACAGA
GTCCGTATAGGCTATCCGGATATTGCTGCCGTATGCTTGCAGCGTTGACTCACGAGGGACTCGGCCGCCATCCGCTCCGCTGGCGCCTTCCGGTGCAATT
TAGCGCAGGTACTGTAGATCAGTGACCTTCGCACGTTGGGGGTGGTTTGGTGGAGCCTCGCAGCTGATTGCCATCTTGCTTCAAGCTCGTGCTCTTGAGG
ATAACGCCACGTCCAGATGCTACTATCTCCAGGCTCTCGATGCACGAACGTCGACTAACCTTATCATTGCGATGCGCTTGTGGTGGAGAGAGGCGGAAGA
GTGCGTTGCAATCGTCCGCCGCGCGCTACTTGTCCGGTTGCGAGCCTCGTGCTGCTTGTGGTGGTGCGGCGGCGCGACGACTTCGTTTAGGTGACCCGCT
GCTAGCAGCCTGCTAGCTCTCTGCTTTTCGATGCGTCGTTTCGGCGTCGTTTCGTG