Description :
From Genome Similarity Track
Location :
Scaffold_134:29565- 43794
Transcript NameFunction/comments
Phyke_g4780conserved hypothetical protein
Phyke_g4781hypothetical protein
Phyke_g4782conserved hypothetical protein
Phyke_g4783hypothetical protein

Sequence
14229 bases(100 bases per row)
GAGTGCTATGAGCAGCGTGTGGAGATCATCATGAAGAATGCCCTAGCCGAGTACAATTTGCACGAGGCGATGGGTCACCGACCGGACTACGGATCGCGTT
GGACTGTCATGGGAAGTGTGGAACACCTCACTGCTATTCGCGAACTGGATCCATCGAGGGCGGTTGAGAACTCTCGTATCTTCGGGCGCGTTGATGGCGA
TTACAACAATTTTATCGACTTCTTCTACTCAACCACGGCACAACAACTCTTCGCCGTGAACCAATTCATGCTTGGGCACGCAATTGATGCCGCGGTACTG
TGCAATATCCACACGAAAGAATCGGGGAAGCCGCATCTGTACCTGGGCATGAAATGGGTTTGTCTTCAACCGTCGTCGCTCTCGCGCAAACGTGACCAAT
GCTTTCTCGAGTATCTTGTTTACACCAAGGATCTCCAGGATCGAGATGTTGGTGTTCGTGTCacgctgccattgctgctggatgaatGCCCTCCGCTCCC
TGAAAAGTTGAAAACGCGGCGTGTTAATTCGCACACAGTGACGATTGTACGCCCGACAAATGACAACACTGACGCCACCCAGATTTTCATGACTAGTGAA
GTCGACGTCTACAAGGGATCGTCCACGTCTTCGACGGCACCATTCAAGAAATTCATGACGACTCTTAGCTCAATGGCTCTATTCGCCGATTCGAAACGCA
TCTCGATGCATGGCATGCTAGACCGGGGCAGTTGGGCACCAAAGAAGTCGCGACCGAGCTGTGGAATCTGTAAGCGCAAGTTTTCAACCACGCGCCGTCG
TCAGCACTGTCGCCTCTGCGGCGAGGTTGCGTGTCGCCGTTGTATGACGGTTCGCGATGCACCGCTACTTGATGAATCGACCTCTTCAAACCCGCGAACA
TTCCAAGTGGTGAAAACAACGTTTTGTAAAGCTTGCATGGGAAAAGTGCGCGACACTGACACGAGTAGTGTTACAACGATGACCTCTGCTGATGATAGCC
AAGACGAAGGTGCATCTGACGCTGAATCTACGAGTTGGTTCGTGCAAGACAAATCGCGTGCTCGCAGCTTTGACAACGACGGCACCTTTACGGAGACGGG
CGGATCTTCGGTCGTATCGCCTTCGCCAAGTGATATGAACTCTGCGCGTTCTGCCCCACTGCCGGAGTCGATTTCCGAAGATGGCCATGACGAGGCGTCT
AGCATCGCTAGCAAGAGCCCACGACGCAAAAAGGCCCCAAGTGGTTGCGACCATGATGTGCAGTCGGAAACGAAGACCAGCATATCGTCCGAGGAAGACA
ACGAGATCGTCGAACCCTGTGCTCCTATGATGATTGACTTGCGCCACCTCAGAACGATGGCCGGTGCGGAACGTGTTGTagctgaagcagaggaagagga
actTCGCGCAATGCGAGAATCATTTGCGGCGCTAGACTTTCAGGATGTTCGTCTTGTGAGTTCCCCCTCTAGCAAGACAGATGATGGATTTTCAGGCGAT
GATACCCCCAAGAttgtggagctggatgaggacgaggacattatcgaagtggtggcgcttcAGACTGTATCTTCCTCCCGACAGATAGTGTCATCCCCCC
TCGCATTGACGCCgctggacgatgatgaagctgtaGAGCAAGCATTATTTGCATCGTCACGATCGAACGTGACGATTGACCAGCGCATCGCAGAGcagga
gctactgctgaAGAATCTTATGAGGGCAGCGAATCCTACTGGGTACTATCCTCAGAGCGCACGCAGACCCGCATTCGAGCAGTAAACAACGTTGCAGTCA
AAACTCTCCGCACAGATTGCGGAGTGAACATGTTGAACATGTACAAACCGTTATGAATCGTCCGGTGTAATTCGATTTAGCTTTAAATGTCGTTGATCAA
GCAAGACCAATGAAGACAATCAAACCCATAACCATTTTTCGCCATTGTTTGTCATGTTCTGTAATCCACCGCAGCGACGATAACATCACTGATGGGGACT
GCGGCTTCCATGAAGTCGATGCAGTGGTTCGGATCAAAGTATTGTTCGCGATCTGCGAGAGCAAATTGCACCGCTTTTCGCTGGCCGGTCCTTGACAAGC
ATCGGCCAACTCATGCTGAACGATATGACCAACGCCAGGGCAGCGGAGCGTGCGGCTTTTCCATCTGAGCAGTGGTGAGAATTCTTGGCGAAGTTTGGAT
TTCAGTGGGGAGTTCTGATAGAAGATCGCTGCTTGCTACCAGTGCAAGCGTGCATGTAGTATTTGACATGCCAATGTTACTACAGCTTAAAATACGTTTC
ATTTACTCTCTTCATTCCTTGTACCTTGGCAATTTGCCACTAGCAAGCGCGACACTGCAAGACCATCGTCGCATCGCATTGTCCTGATAGACACGATAGG
CGATCTGCATGTGTGCGCTGCGACTGTCCAATACAACTAGGTGAGCTGTCAGCTTTTAGATCACTGATACGTATATTCAGTCAGCCGTATGCCTTCCTCG
GGGCTGCGATCTGTCACGGGCAGCCCGCATTAGCCGCTGCAAgagtgcttcttgctctgcaaTGCATTGATCAATCGTGCGGCTGGACCTGCTGGAATCA
TTTGACACTTGAGAGGCAGAGTCGGTCGACTCGAAGTTAGCGCCAGCCTTGATTCGACGCATCATTTGCGACGCCGACAAGAAATTTGACATGTCAAAGC
CGATGGGGTCTGCAGATTTTCCGTTGCGGTGGTCATCCAGCTCACTGTGGCCGTCGTCATCTACAATACCATCACGGGACCCGGGTGACCGAATCGTCTC
CAGTCGTTCAGAGTCTGAAGACGAGCGAGGCAAGGTCGCTAGGTCAATTGTATAGGAGTCTAGGGAACTTTGCTCACCGTCAGGTTTTGTAGAGGTACCG
GAGTCCGCGAATTCATCGATTGCCTTGCTGCTGGACCCTGGCGCTAGTAAAGTCACGTCCAAATCGCGAACTCTAGCTACGCACACACGGCAGAACTTCG
TCTTCACAACGTTGAATGTTTTCGTTGAATTCTCGTCTTCCGAATCGCGAGCACCACGGTAAATTAAACATTGGCGGCAAAAGACCTCACCGCACAATCG
ACAATGCTGGCGGCGACGTGTTGTTGAGAAATCCCGCGAGCACAAGCGGCACTCTGACCGTGACTTTTTGTCGACCCAGTAACTGCGCTTCATCATGCCA
TGTACAGCGATAAGCTTCGAGTCCACGTAGTTGGACATATCGTTCAGCTTCGCCATGAGTCTCTTGAAATAGAAGCCAGGAACAGCGAAGCCGGCAAAAT
CGTTTTGACTCACGAGGAACAGCTCCGTCGAGTACATATCTCCATCTGTGGGGCGCACGATCGAGACAATTTGCATCTGCATGCGCTTGGTTTTCATTTT
GTCGGGTAATGGTGGGCACTCGGGCATCACAAGGGGTAAATTCACTCGGATCCCCACATCACGGCCTCGCAGGTCTTTAGTGAAGGCCATGTATTCGAGG
AAGCAGGTATCGCGTTTTTTTACCAGTGCAAAAGGCTGAAGACACGTCCACTTGATTCCCAAGTACAAATGCGGCTTGCCTGAGGAGCTTGTGTCAATGT
TGCGCAGTACCGTGGCGTCCACGGCGTTGCCGTACATGAATTGGTTCCAGGCAAAGAGTTGGCAGGAGTTTTCTGCATAGAAAAAGTTGAGAAAGTTGCG
GTAGTCCCCATGGAGGCGCCCGAAGATGCGGCATTGACACCTGGACTCGTCCCCGTTCTGCCTCACCGTGGTGAGGTCTCCAACCTTGCCCAAAGTCTTC
CAGCCCTTGTCGTAGCTCGGGTTCGAGCCCATCGCTTCGTGCAGATTATAGTCGGCCAATGCATTTTTCACAGTAAGCAGTGCCTGCGCTTCgagttcct
ggagctggagcactGAGAGATTGACATTTGGGAAGTAGTCGTCCGGCAGGGGGAACGAGTTCTGCTTGGTACTGGTAGCCGCCATGTTGGGTCTAGCAGC
ACACAGAGAAAGGTAAGTTTTGGGGGTGAATGCAACCAATAATTTTGTTTTGGGGAGGAGGGGGCTTTTACGGGTGATTTAAAGCCGACGGAACAGCCAC
AAACATGGCGTAAGTTGGGCAATGTGTGTGCTGCGACGCTGCTGCCCACCCTCGACGCGCGAAAGTTAACCTTGCAACATGTGGCGATGCGAACAGACAG
ATGGGGCGAGAGCGCGGATGACATGATAATGCGCGGCTGTATTGTGGCAAGTCAAGGTGATGTGTCAAAGGACTTGATCGGTGTGAACTCGCACGCAATG
GCATTCACGCTCGCATGTGGGTTGCATTGTACCTCACCGACACCCTtcaccagcaaagcttcATCGGCGATCGCTGCTGGCACGACGGCCCACGCTCCGG
AACTTTGGCTTGATCGTCTTTGTAGCCGCAAATCCCAACGTTGAAGCCGCCCGCCAAGCAAATCCTGCAGTTGAATCTCAATCTTGAACACCATGGCATG
GCCACGAGTCGCCAGTGGCAGCACGGCGACTTTCGCGAGTGTTCAACTCGTGAGTCACGAGCCACCCAGGTTACGTCGCGCCATTTGTTAGGTGCATGGT
CTTCAGTCATTTTCGGTGCAAATTTTAAACTGCATACCAGCGATTCAGACAGTGTACTCGGCTGCGTCAAGAAGTATGAGGCGAGTGCGACGTCATACTC
AAGTCTTAGGCGAATGTTAATAAAGTTTTCATTTTGCTCCAGTTGTTTCATTAAAGTTGTGTACTCGGCTGAACCGAGTGGGTTTGCTGGTATCACCGCT
AGCTTCGCGATGGTTGACTATCTCTATGGCCACGAGAAGCGGTAGCGACAGAAAACAAGCTCTCCTTATAACTCGTACACGCCATCATCGTGGTCTTCGT
CGTAGATGTTGTAGCTCACGGATGATGCCTTGGCGCGTGCCGGGGGCTCTGCATTGAACCCGCGGCTAGCGGAGAGCACCTGCTTCAGAAGCTCGTTCTG
CTCAGCGATACATTGGTCCAGCGATCGCGTTGGGTCGGATACCTTGCCCTGGTCCGTGCTGCGCGTGCGTCGGCCACTTGCGCGCGGGGGCAAATCCGTT
GGTGCTACAGGCGTGGATGTGTACCGAGCGCGGGACGTCTGCTGAAACTCGTTGAAAACATCATTTTCAGCATCCTCCGTTGACGtagcagaagctggag
gctgctggcTTCGCAGCTGCTTCTGAAGCTCCGAATCGGGTAACATGTCCTTCGTGTCGATCACCTCCATGATACTGGAGCGCCTGGTGAAATCCACGTC
GACACCCTCGCATTCGATCTCTGATGGAGTCTCCAGCGCCTGAACTGCAACGAAAGAGTTTCTGCTTAAAACAGAGTATTCAGAGCTAAACGACGAGCGA
ACAGTGGGGGCGCCGCTGTAATTGCGCGACAATGTGCTGAATCGGCTGGACCCAGACTTCCAGCTACACGTGTCAGACTCAGTTTCAGACCACCACGAGG
TGCGGGCATCATCGCTCCAAGTCGCACTACGGCGAGGCGCGTCTACCTGACATGCCTGAGCGTTGTTCTGTaacgaagacgcagcggATGAACATCGTGA
CTCGCGGGGTTGAGTGGACGATCCGTGTGAAGTCAAAGAGGGGCGAAGCACGGATGACGACTTTGAAGATGTCAGGGAGCGTCGACTTGCctcgacttgc
tgctgtatcaGTTCGTTCGCGTCCTCTTCGCGGGAGCGGGTAACGCACACCTTACAAAACAGCGCCTGCGTCAAGCGGAACGTTCGCTGGTTGGCCGCTG
TGTTAAAACCACTAAAGTTGCTCTTCTCCTGTCGAATACCAGCTCGGCGGACAAGGCATTTGGTGCAAAACACATCGCCGCACAAGTAGCAATGGCGGCG
TCTGTGACCAGGGCGGAATGGTCGTGTGCAACTAGAGCATTCATGCCTAGTCCGCGTCGGTACCCATGGTCTAATAGTGTCTCCAAGGGCCTGTGGTTCG
CCGACGCGTGACTGCTCCATGAACCCGGGTGTTTTAATAGCTGTAGCAATGCGCTTGGCATCAGCTGATAGTGATATATCCTTCAACGCCTTTAGCAGTT
TTCGGCAATACTTGGtcgaagctgcaagagcgCGGTTATTGCATTGGCTCAGCGCAAACAACTGCGTCGCGTTCGGATGgtcatcagcagcacgcacAAC
TACAACTGTTGTGGTCTTCTCACGTTTTGTCTTCATCTCATGTGGAAGTGGCGGGCATTCGGGGATATCAATGGGCATATGCACAATCACCGCGACATCG
CGGTCGTGTGCGTCTTTCCTAAAGACAGTGTACTCGAGGAAGCATTCATCGCGCTTCCGCGTGAGCATTGAAGGTTGCAGGCAAGTCCATTTGATCCCTA
GAGAAGCCTGCTTGTCGGGTTTGCGCAAGTCCATATTGCATAGCACAACGGCGTCCACTGCGCATCCGTAGAAGAACTGGTTCCATGCGAATAGCTGCTC
GGAAGTCTCGGACGAGAAGAAGTCAACGAATCGACGATAATCTCCCGTGACTGTTCCGAACGTGCGTATGATGCTAACGCCGCGCTGTTTGCGTCTGGCA
ATGGAAATATCCGTGTCGTGTACGATTTCAGTCCAGCGTTTGTCCTCCAAGCCAAATCCTGCGACCCGAGACTCGTGTTCGTTGCAGGCCTCAACCGCTT
TgttcgccagctcctccacttgGGCTTCGTACTGCTGAACTTGGGTCAGTGAAAGGCTCACTGTTGGGAAGAAGTCATCTGGCAACGGGAACTGGAGCTT
GTGCCCTCGAggtctgcagcaagaagttgTTAGTCAATTGATGTGCATCGAAACGGGTACCGTAATTTCGGCCGTTACAAACTTCAGAAAAGCTGGTGGA
CTGCAAGATGCTGCCTTGGTATCACTTCAAAATTACTTACGTTGACGGAGCTGTGCTGGTATATGATGCCGTACgcggcagcgatggcgacgacgtgCGG
GGCATGACGTCGACGATTCAAAAGTGTGAGCAGCGAATCGAGAATCTATCGGTGGCTCCGTCGAATCGTTGCGTTGTTCCGTCGTGGGGTCTTCTTGAAG
CCTCACACTGGTATTACACGCGGACGTTGGCAATTGAGAAAGTAGTGCACAATGGCAAGAGCGGGTGGACGAACGAGTGGAGCCAACGCTCGTTTGCAAT
GCCGCGACTTGATTTTTTCGCGGCGTTAACTGCTTGAGTATACGTTTTTAGAGGCCTCAAAAGCTGCAATAGTGCTGCATATTCTATGATATTCTAGTGG
TGAGGAAAATGCACTGCCGATCCCAATGGCGGGGTATGCGCTACCACAGTTAGCGCGAGCAAGTTGCTCGTTCAATCGGAAGATCATCAAGGAGATCCGT
ATTTCGGGGCATCTCAGAAACTTCTACTAATTAATGCTTTTTGGACACTGATATAATACTCTATATCATATTATAAAGAGAGAATATGAGATGCAATATC
TAGGTAATGAATTTAATATTAGCCATTTTATCGAATTTCATACGTATCAGACGGCGCTTCCGTATCATTATATACAGGTTGATTAGCCCTATGCCCGGAA
GCCGGTTCATCGATTTGTGGACGTCAGCACCCAAGGTGGTCTTGGATTGTGTCCACGATGGCTCCGTTGCGAATGCGTAGCGCCAAGTGAGCAGGATCGC
CTTGACGCTTTGCAAGTAAAGACTTCTAACGTTACAGTATGTATACCTGCAAATGTAATGATCCGTGTCTACTGTAAACCTGTGGCTAGCTCAGCGGGTT
ACCATCTCGATCTCAATATCAAAACTCGGTCAGGTTGACCAATTAAGTGAACTCCGCACAAATAAGAGCACTCATTCCATTTACGTTAGCTTAGGGGTTA
ATAATGCAGCCAAGGCTAATCAGTTAGCCTTCGTAGAGGGTAACTTCAGGGCGGGATCTGCTTGAGGTGACGCCACTGCAGCTCATGTTCGCACTGCCTG
TGATCGAGTTCTCCTCCCGCCTGATACCGCCACTAGCCGACAGCATCATccgtcgaagaagctcttcctgctcagCAAGGCGCTGGTCGAGGGACCGTGG
CGACTTGGGAGCAAGCGGAGACCATCCGGGGCTCCCGTCTTGGCTTGAGGAGTTTGCACTACCACGTTTACTTGCAGTGTACGTCGAAACCGGCATCATG
TCTGTTGTGTCGATCTCAGTCACCTCCTCTTCCATCACCTTGGTTGCAGTCATTCTTGGGTAAGCGAGAATTGTCACGGACTCGTCGTCAATCACGTCCA
GCTTGGACATAAAGGATACCTTGCCCCCGctcgaggagatcgagattggtccgtcgctgctgcccGTCTCGGAGAAGAACGACATGTGACCTCCCTCCGA
TTCTGTTTCAGAGACGTACGACGCGTCAAGCTCCACATCATCGCAGTCAATAACAGAGAGCTTGCCGCTGGGTGCAGGCACTGGAACCAACGTGTTTTTC
GACGACTCTCGTATCTTGGTCACACACAGCACGCAAAACTTCGTCTTGACGATATTGAATGTCCGACTCGATCCCGCCGCATCGTCTGTGTCGGTACCCT
CCTCCTTGGGGGCATCGCGCACAATGATACACCGCCGGCAAATGAGGTCTCCGCATAGGCGGCAGTGGTGCCGACGTCGGGTCGGCCCGAAGTTGCGCGA
GCacacgctgcagctcttaCGTGAAGCTGAGGTTGCCCAGTTTTTCCGAGTCACCATGCCCTGCATTAAGATGCGTCTCGAATCGACGAACACAGACATG
TTCTGGAGGATATTCATCATGCGCTTGTAGTAATTGGCAGTGACTGTTAGGCCGTTGAAATTGTTCTCCGACAGCATGAAGAACTCAATAACATTTGGTT
CGCGGTCTGCAGACCGTGTGATCCAGATCGTGTTGAGGCGAATACGCTTTGTCTTCAGTTTGCGAGGCAGTTCAGGGCACTCTGGAATATCAAGCGGCAG
TGTGACGCGCACGCCAACGTCGCGACCACGCAGGTCTTTTGTGTAGATAAGGTACTCCATGTAGCAGTTGTcacgcttcttcacgagcgGCGACGGGTTG
AGACACGTCCACTTGATGCCCATGTATAGgcacttcttcttggacgacACTGTGTGGATGTTCTTAAGCACGGCTGCGTCCGTAGCGTACCCGAACATGA
ATTGGTTCCAAGCAAAGAGCTCCGCCGACCTTTCCGCGTAGAAGAAGTCGATGAAGTGCCGATAGTCTCCGTTGACGCGACCGAAGATGCGCGCCTGACT
GGCAGCATGGCTGTCCGGGGTGTCTCTTTTGATGGTCGTGAGGTCTTCCACCTTGCCGACGAGGCTCCACGGTGCACGATAAACCGGGTAGAGTCCTTTT
GCCTCATGCAGTTCATACTCGGCCAGGGCGTTCTTCACGATTTCCTGCATCTGGGTCTCGTAATTCGCAATTTGCTGCGGTGACAAGTGGATCTCTGGAA
AATAGCCGTCGGGTAGAGGGAAGTTACCACCGTTGTCGTGCATGTTGTAGCCGAGCTCACTAAATAATATGAGAAAGCAGACGAGGTTAATTATCGCATT
CGACTACGAGAGGGTGTTGGATGCGTAGCTAACGTACCGGCCTGAAGAATTCGAGTCCGAAAAGGATGACGCGGAGTCCTGGCGGGGCATGGTATTAACG
AAGCGGTTCCGAAACAACTGTGAGGAGCGTCGCAAGTCTTCAATTGCAAAGGTGTTTTGGTAGCTGAATATGCAACTTCTTCCTGATGATAGCGACTCGA
TTCCGCTACGTAGCTCGCCAAGTCAAGAGTGAGAGTGAGGCAGAGCGCTCGCTCTTTCTCGTTGCTTGGTCAGACAGACATCTGCATTTGCCACAGTGGG
ACAAGCGTCATGAGCTTGGCGCCAGCGCTGTCGCCGTGACATCTGGGAGGTTAGTACTTGGCCATCTTCTCCATATGATCTCGGCGGATTTGCCCGCAAT
TACTTgctttgcaattgcaagtTACTAGTCTTACGTCTTGCCCCCCGGTATTGACTACAGTTCGCCACAAGTTGCTTCAACTGCAGTCTGTCCACCAAAA
CGTCGACAGTGAAAACGTTTATCTAATGGACTCAACACATCCAGAAGATTGCATACGCTCATGACGTTGTACCAGGCGGTACACATACATGCACTTCAGC
GTTTGGAGTCCCGCTGAATTTGTCACACGTATCGCAGCGAAGTGTGGCCGGCCTTGAAGCTCCTGGAAATCCAGGACCTGGATCTGGACACCAACATGGA
AATGTTGATGTCGCGATTGTCTAGAAACACCTGGCTGCAGGAACTTGCTATTTGAGCTGGTCGGCGGCTCCTCCACTGTGGAGGAGCTGAGTGTGGAAGC
CCCACGTAGCATGCAGCCGTATCAAACAGCCCGCATGATGGTGCTGTCTCTGGCGTCGACAATGGTAAACAGATTTGCGGGCAGGATAGACAGTAGGCGA
CAACGTTTTCTCAGCGTGAAGGATGGCATCGGTTTATCTTTTTGTGGTTTGTCGTCACTTCCAGGTGGTGAGGAGCCCTAGCGCTATCACCCGATGCCGC
CGATACAAAACGCTTTCGGTAATGTAGCAGTGCAACGTTTGCTAAGGAGTTGTTTTGGGATAGCCATCGGATAGCTGTAGACTTCAACGTGGCGAAATTG
GTTTGCCATCAACGGATGCGCTATGCTCATCTAGTGAGAGAAAAGAAGCACAGGGCCATGTCCTTTGCTTGGCTAGTCAGCACCTTTGACATGGACGTCA
ACACGAGCCTCGTTTTCGCCGAGCATGGAGCGCAGCGATCGGGCTACCGATCATAAAGGGGCGGAAATGGTGTTCCTCCCCGGTCTGTCTATGCGAAGGA
ATCTTGGACACCGTATGCAAACATTGTTTTCCCAAACAAGTCCAATCGCTCAAGAAAAGCAGAGCAGCATTGCCCTTTGCAGCAGATTCTGCGATAGTGC
TGTGTACCTGTGTTCGAAACTGTTTCCCTCTCGGGCAAGCTCGGGAGAGTCGTAGAGTTGGCTACGCGGACTCACCAAGCGAATGCCTTTAGGTGGCTGG
TGCAACTTCAAATCTGCCTTTCGCGCTAGGAGTTCCTATCAAGATGTGCATTAggagaggaggaagaaagcacgcCAGGCTGGGGTGGAATACTGACTTG
GTCATCTGACCGTTTTCGTCGGTGACTCTTCAAGATCGAGCTCTGGAAAATGGAGGTGTTGGGCGTATTTCAAGACGATGTGGACGTCCAGGACACCACG
ACTCCTATCGATGACACACACGCGACCAACCGTGTGCGGGAACGAAAATTACTGCACTGGGTCAACTCGCTGCCACTCACCAAGTGTTTGTTGGTAGAGG
ATCTGCGTGACCTTCGCTTTGGTGATGTATTGCATGAGATTGTGGAGTGGCTACAGGTGTGCTCGCTGATAAAATATTAATTGTACTTGCTGTCAACTGA
TGCTCTTGGTGGATGTGCGTTGATGACAAGCGAAGTGCAGCGCTGTTACCGGTAGTAACACTGCCTCTGAGGTTGATGAATTCGCTACTGATACAATGAT
AGAACGCCTCCGCCGAGTCGTGCAGTTTGCCGCACGTGAGTGTCGAAGTCAGGATACAGACGCCATGTACGTCGTCAACGACGCCAAGTGTGTGGAGCGA
GTGGTTGCAGGTCAGTACGACTCAATTTGCGCAGTGTTAACTGTCTTGAGGAGGTTAagtgtgcagcacctccgCACGCTCCAAGAAGCGAAGTATTACA
GACGTGCTCTTCACAATCGATGTGCCCAGGAAGAGGTGATCAAGGGTTCTTTGCAGCAAATTCACCCGGTGGATGAAGTACCAAAAGAGGCTATGGAGCC
CAAGCATAAACCTAAACGTTCGGGACCTTCGCAAACAACGGCCCGCAAGTCACGAAATGCAGTTAAACAATCTGTGACTGCTCGTAAAAGCCCAAGTACA
CTGCCAGTACAATCAAGAGCTCCGAAGCAAGGAAGCACTAGAAGATCTGGTAGTGCAGCCGGGACGAGAAAGAAGATCGACGGCGGGGAGACCTCCCGCG
CAAACTCGACCGTAAAGCCGATGACCGACAAAACAGTCTCACATCAGCCCAATATATATCACGACAGTGGTGGGCTGCACGTATTTGGTATGGTGGACCC
TAGCGCCAAACCTCCACCTAAAGATGTAGCTGCAAGCTTAACAGGTGAAAATGGCAGCTCCAGTGAAAACGCTCTAGCCATTCGTTTCTGCAACTGGGCG
CAGCACATCTTGCAGGTTCAACTTCCTCTGGAGCAGATATTCGTCAGAAGCCGTGGGGACTTGGTATTGCGCTCTCAACAAAAAATCCGACAAGCGTTTG
CGAATGGTGTATTGCTTTGTCAAATTGGCGCTGCCATTACGAGCCACTATGGCGTTCGGCTCAATCAGAGCTTTCCTGCCTCCGAGGAGCTCCAATCGAA
TGAGTTAGTCCGAGTGACGAACCTCCATACACGATCAGAAAGTCACCGAAACATGGAGATAGCGCTTACTGCATTCAAGCGTTGTGGACTTTCGAGTGTG
GCGATTGCTTCGATTGAAGGTTTGCAACGTCCAGGAATTAACTTTTCGTTCAAAGGGATGTGGAAAGCATTGAATGAAGTTATCCAGAGACTTGAACAAC
TCCCACACGTCACTGTTACTCCGAGCGCTCAAACGGACAGTAAAACTATCGAGAGAGGTCATGTGAAGCGCACGCCACACAACACTGAAACTCGAAGTGC
TGATATCATTAGCTCCAAGCACATTACATCTCCTCTATCCAGAAAGAGCGTGCCTACTTGCTCCAAGCGTCCCAAGACTCCTCTATCCAGAAGAAAAGAT
CCTGAAGAGGACTCGCTTAGTTCGTGTGCACCATTGAAGCGAAACAGACCTTACATCACAAACGAGCAGATTCATGTGGTGGATGAGTGGCTGGCTAGAC
TTGGACACGATGTGAAGAAGGTGGGTATCATTGGGGGCATTCGTCGTCGAGTACAACGAGTTTTAATGCTTCTTCGATGCTGTAGGCTTCGATATCCGGG
GTATTGCACGATCCGATGCGCAACGGAGTCCTGTTCTGGTAGTACTCCACCACGATATTGTCATCTTGCTCGTATAAACTGCCAGCTGACACTCTTTGAT
GTTCGTCGCTTCCTATTGTAGTCTATTGCTGCTTCTAGTGCCATCGATCATGCCATTCTCGTATTGTAAATTTCCACAGACTTTGACAGACATGAGGTGG
GTCGTTTTCAGGGACTCTGAGATAGAAGTTGATGGTTCTCTTGCTCACCTACAAGCGCCCTCGTTGTGCACAGAGAAAACATTTCCAAAGCATTTGAACG
ACTCGAGAAATTGCGTATCCCGACATGCTATTTAACCCCTACCGCGGGGCAGGCTGTCCTGATGGGCGAACGACAGATTAACTACGGGATTTTGTGGCAT
GTCTGGCAAGTTAGCCAAGAACAGAAGTGTTCTACTTCAAGTATTAGTTTCAATGGTATCGGAGACGGTCTGAAAATCACGAATGAAGACCTCAAAGGAG
TGCACAAGCATCTGGCTATCGATACCACACCACTTTCTTCAACAGAAATTCGCCCCAGTCCACTGCTGTTCGATGTACCAGCGATTGCGTTGACTGGTCA
AGAGAAGCCCCCGAGCAAAAATGACCAAGGCACGTTTGTGCATGTTAGACTCGACGAAAGTTTCACTCAGCATCTTGCATGGGGAGAAAATCACGCAAGC
AGTaatgacgatgacgatgtgTTTCCAGTACCGAAAGCACCCTCATCGAGTCCAATCCGCAGCGAAGAAATCTTACCAACCCCACGCAAGACACTTACTG
ACCTTTTCGATGCAGGCCCATATGGTACGGTAAAGTCACCGGACCAAAGCATGAGCAACGACTTGTACGCTCGTGCAAACGAAAGTGAGGTCATTTCAGC
TTTCAGTCAGGATGCTGCCACAAGAGTTGCGAGCCTTGTTACTTCAGAATCGTCAGGTGAGTACTTGGTTCGAAGGACACCTGTATCCAACAAAAATATT
AAAAACCATCGATCCGAACGACTATCAGATATCGCGGTTGACACAACAATGCAACGCGCAGAGCTGGCAGAATGTGTAAAACAGTGTATCGAAGACGTTC
CAATATCGCCGTCTTCATGCAAACCCAAT