Description :
From Genome Similarity Track
Location :
Scaffold_300:29563- 32534
Transcript NameFunction/comments
Hyaar_Emoy2813637hypothetical protein

Sequence
2971 bases(100 bases per row)
AAACATAATCTGACCAGGAACAGCGGTGGCTTGGTCAAACGGGAAAGGCTTCAAAGGAGTACCCTTTGGCGTATCATCCATGCCCGTGTAGTTAGCACGA
CCAGTAGCAGGCGTTTCAATTGTGATGCTTTGCGCTGTGATGTCTCCAGTACCAGAGCTATCGTTGTCAGCGAGACTAGATTTGCGATCCAGACATTGCA
CCGGTCCCGCATATTTGATGGGGCTACCCTTCTTGTCAAGCGTAGCATCGCTTCGCCGCCCTTGGCCAAGAGCACTGAGATACGTGCTACCACGGTTATG
ATGAACGGTGGCTTCGTCCATGCTGAGCATAGCAAACTCCTCAGCTTCCCCGTCACTAGCCCCAGCAGCTCCGGTACCGCTGTGTATTCCAGTGCTTGAA
AATCCGAACATTCCCCGGCCCTTTTTCGGATGTCGCTTGTTGACGCATGCCTCTGGATCCCGGTCGATTTTAGCACGCAACGTTACAAACCCAATCACGG
CCAAGGCAGCGACCACGATGCCGCTAATGATAAGCAGACACATCATTTGTGTTGACATACCTAAGCTGTCCGACCGAGCAGTTGATTCAGAATACGGTGT
GGCGACGGTGTCTGCCACTGCGGAACCCGAGAGGACCAGTATCTTCAGGAAAACCGCATAGTCGTATCTCTTAGTCGCAGGCGCGCTGCTAGGCAGGATC
AAATGGGCCACCAAAGAATAAGTTCCAGCAGAGGCAAACGAGAGCTCCGATGATTCGAATGCTGCCAGGCCATCCGTAAAGTTTAGCGGGATATTGGTTG
TGTTCTCGGTCAGCTGTGACCCCGTCGTCACCGGGTGACAATTTATACCGTACGGGCACGTCCGTAGACGTGATGCGGTGATTTCATAGTACTCTTGCGA
AATTCGGTCGAGTCCTGCAGACAGACTGGTCAGGCCAAAGGCATTCTTTTCGAGAGCACCGCTTGACGAAACGCGCTTCGTGGCATTCCACGAGATGGCC
ACCGGACGGTAGGCGCGCACGTCACCTGAGGGAATGGCGATCGACAGCTTCAGTGAACAGCCAGCGCCCTCGGCGCTCACGACGTTTACAGACGAGGCGT
CTACCGTGTTGGAGTATATTGACGTGTCAACCTCCCAGCAGTACGTGGTAATGCCATCCATGACGAAGCTGGGCGAGTGGGACACCGCGGACGTCGCTGT
AGCCACGTTGACCAGCATCAGAGCTGTAGTGACGATGGACAGCCACATAATTGCACGCCTGTTTGATCTCCTGCTCTCGGTCCGGAACCGATACCAGCCC
TCTCTTGTTATTCTTCTTTAACGCTGCTGCAGGAGATTAAGACACCAGGGCTATGGACGACTAAACAGTTTCCAAAGCACGATCCCCTTGCTTAGACAAC
TGCTCGTGCGTAGAACAATGGTCTATCGCACAAATTTGGCCTGCGCTTTGTCTTCGCTTTTTCAAGATGTTTGCTGAGCTTCTTCTGGTCAAATGTCGTC
GGTCGGTCGCAGGCCAAAAAACATTAGCTGTTCTGCATATAGGGCTGGGTTACAACCTGCGAGGATACGATTGGCTTTCCAGACGCTTCTTCTTAATGAT
GTGAAATAGAACTGCTCTGATTGGCTGGTATTTTTCTTGAGATCTGAAGAGATGCCGATTACACACACGTAGCATGAGCACCAGCTGGTGGAAAAGCTGG
GCAGCACTGCGAGCATGGTTTTTCTCAAGTCAACTGTATCGCAAAAGCACACACCGCACAAAGCTGTTAACGCATGTTGTTTCGTTGCGTGTAGTTAATG
CACTTTCATCGACAACGACCTTCGACTTAGACTCACGCGTAAGGATGCAGCGAACTAACATGAAGTAATTATTTGCGAAGCGTACGATAGTCCAGCAGCC
GCTTACAAAAACGCGCAAGAAACTCAATGCACTTGCTGAGATAAGTATACGTGGCAGATTGAGCAAATCGGGCGTCAGTGGCGCGGCGCCACCAGCGCGG
ACAAGCCCACTACTTGTTGGTTTTCAATGACTGGCTCAGCAGAATGCTCACCGTGGTAATTGTTTATATAGTTCTTAATGGATAGGTCTTCATCTCAGCC
ACTGAACTCTCGACAAGCGACACAACGATTATGTGGAGCTACGGATGCAAATTTTTGGGTGATCTCAGAAACATTGCTCGAGCAACACGTCTGACAAGCT
TCGACAATATTTTAGATAGGTATGGTAGTGGATAGAACCAGTTTACGGTTTGCAATATCTGCGATACCGGTTTTGATCCGATCTACTCATACCGTCCCGG
GACCCCCCCCCCGGTTCTATCCGATTCTCACTTACTATGTACCGTGCTGACATTCGACATTATGCTACCACGTACTCAGTGACGGCGTGCGAGGTCTTGC
CGAAGCTTTTGCTCAGTTTGATTATTTATCGTGCTTTTGCAAAAATTTATACTTACATTGCAAAGGGTCTCTTTGGCTATTGGCGAAAGTCATCGTGTCC
GACAACAAAGTATGACTAGGAGTGGTTGACAGTCCAGTTGGTCAGCTTCAAATCACCATACTGGTAACCCGCCAATATGACTTCTTTCACAAGGCCATTT
GACTCATCTCATTGGGTCCGGCAATGGAGTCGATTTACGATGAGGATTCTATTTCCAGGATGTTTAAATCAATCTATGAGTTTAGATTTGGTTGTATGAT
GATGCTTTCTGGAGTCTGTGAGAAGTCAACTTTCCTTTATGTAGCTATACAAGTGCAACAGAATAATCGTAACTCGTGATCGATGAATACCCTCCAATGA
AATTATATACATCGGAGCTCTTGACACTATCAGATTCACTTTCACTACATACAGCGATGCATATGGTGATACGTTAGTAGCGGAAGTGGTGTTGCAGTAG
CTCACGATGATTCTCGAAGCTAATTGCTGTCAATCACTTCTGTCTGCAACGATCTCGGCCTTTGCCCCGGA