Description :
From Genome Similarity Track
Location :
Scaffold_79:295559- 297975
Transcript NameFunction/comments
Physo_158055hypothetical protein
Physo_139888predicted protein

Sequence
2416 bases(100 bases per row)
CTTGTTTTCCTAAATATGAAAATATCAGCATTTTCACGGTGAGGTAGTTTGAAATGAAAATCAAACTTACCGGTGCAGCGTCTTGAGCGCCTCCCTTTCC
TGTGATTTTTCTACCATGCAGACCAAACTGGTTAGTTGCCAATAAAATATGCCACAAACATGCTGCACTACATACTTTCTCAAAGACACCGGTCCAGCTT
TTTTGTCATCCGCGGTCGGGCTCTGGGGAGGAGGTGTGATAATGTACGGATAGTCGGCCTCACTTAGCGTGCGCTTCAACGCATTGGTCACAACCCCCTT
GATCTTGGGGTCATAGCGTGCGTTGGAGTACTCCACCGCTTCAGCTTTTTTCGTCGCTAGCTTCAGGTCATCGCTCGACAGCAATGAATTGCCATTCTGC
TTGTACAGTTCAGTTCCAGCCACCAAAACCATGTTTTCGAGAATAGTTTCATGTTTCTTCGAAAGCATCGCGGATTGCATCACCTTACTGCGCTCGGCTT
CCTTCATCGAGTCCTGTGTGAGTGCGAATACCGCTGCAACTCGGAAGCGGTCTTTCTCCGTCAGCTTGGGATCCTTGAACAAATCCTCGAGCTGCTTCGC
AATAGTGGTGTGCTTCAGCTTCTTCCCTGATGCTTCAACCCCCGTGGCCAGGGTTTGTTCAATGTTGGAAGCATCCAGCAAAGCCGTCGAGGTGAAAATA
TCCATAGCCTTTCCTGCCAAGAACAAGTGCTGCGACAGCTTCCCCAACATCTCTCGGTACTCAGGAAGCTCACGAAGACCTGCAGCCATAGCGTGAAGAT
CGGTGCTCTTCCCCCGCCCCAGTGAAGTACCGGCATTCGAGGCCGACAGTGCATTCATTCGCATGCCAATCTCGGTACTAACTTGAGCAATGTGCGTGTG
CCGGAACTCCACCCACTGTTTGTCGTTTTCATTCAGAAATGCTGTCTTCGTTGTCGTCCCTGCATTCGTTTCCGCCTCGTACGAGATCTGGTCGTCCTTC
ACTTCCAGTAAATCGTACGTCATGGCCTGAAATGTGCTCTCGTGCATCAGCGGCGTTACCATATCCTGCCCGCGGTCGATAAACAACAGCGTGCCTCTCT
TTGGTGCGTATGAAAACGCCGAGTTCTGTGCCAAGTAGTCGTTCATCTTGTTCTGGAACATCTGCGCCAGCGTCTCCATGCGCGCATGTCCAATCTTGTA
CCTCACATAAGGGTACTCTTCCAGCGTCGCACAAACTGACACCAACTTGCTGCTGATCAACTGCATCAAGTTCTCACTGTCGCTCTTCTTAACCGCAGGA
GAATATAGCGTATGGAAGGCCTCGGGCATGCCGAAGGTGAATGCGCACTTCTCCAGAGCCAAGAAGTCCACATTGACCTCCTGCAAAGCTTTCAGCCTCT
GTAGTAGAGATGGAGGAGCGTTCTTGAGCTCAGTTAGAGCGTCTTCGCCCGCGTGGTGCAGGAAGTACAGGTACACGTCGTTGTACTTGGGCTTGGCGGG
GTCCGCGAAGTCTCTCGCCAGGCGCCGCACGTTGGCGGCCGTGGGGGCGATGAAGTAGACGGCATTCATCTCTGGGAAGGGCTGACGCTCGAACTCCATC
CGCTCCAGCAGTGACACGCCACAGTCCGTCAGCTCGCTCATGCGCGCCACCTGCGTGAGCGAGCGCGTGGCCTCGTCGTCCACGACCATGATGACCCAGC
CGCGCGTAAGCTGCGTCACGTGCTTCACCATCTGGAGCAGCACCTTGTCCTGCACCACCTTGCGCAGATCCACATCGTGCCGCGCGGCCACGGACGTCGT
CGGCGGAGCAGCAGAGGCGGCGCTCATTTTGCGGTGTGCGAGTCCGTTGCAAGAATGCGGAAGCAAGAGTGATGGTGCGTCGCTTCAACATGCACATCAC
CTTTACACTATATTCACGTGGTGCACACAAAACGTAACCGGGTTACGTTCGGGTGGTTTTGGCGGGAAATCCTGTAGTGCTGGCGGATTGCCATTCCTCG
AGTCGAGCAGGAAGCGCGCAAAAGGTTACACGACACCAGCCCGCCATGCAGAACGTGGGCAATAGCCGACGGCAGCAGGCCCCTCGCCAGGGCCTGTCGA
TGCTGTCGCTGTACAATGAGGCGCCGCTGGTGGAGGTGTCGCTGGAGCAGTTCGAGGAGTTCGCCATCGACCGGCTGCACGTGCTCAAGGCCGTGGAGAA
CTACCGCCTGCGCAGCGTGCAGATGAAGGACCGCGAGGGGCGCCTGGAGAAGACGCTGAACAAGCATATGCCGCTGCGTGCAGCCGCACCCATGCGCGCG
GGGCAGGCGGAGAATGACGCGACCAAGGACGTGCTGTCGCACTTCTTCCTGCGCATGGCCTTCTGCCAGACGGAGGAGCTGCGCCGCTGGTTCCTGACGC
AAGAGAGCACGCTGTT