Description :
From Genome Similarity Track
Location :
Scaffold_33:295555- 297031
Transcript NameFunction/comments
Phyci_6412Hypothetical protein

Sequence
1476 bases(100 bases per row)
NNNNNNNNNNNNNNNNNTCTCGTCGAGCACTCTTTCTCCTCCTTCCGAGCAAGTtcacgtcgactctggcgcttctctcgaatggtttccagacactggc
tcggaggcggagaatttggtcgtcggatcagtgattgagttatcggagggcgtcccccaatcttcttctctcttggagcttccaggttccgagtcgtcgg
gagctgtcccgggtgttggcgtggagcctaagaagacacctcctgctccaccgaagactcgcacgagtcaccgtcgacaacgccgtcgtccctccattcc
acgccagcctgcgtcttccggaagcaaccgggtcgtcgccactttgtcgtccacccctgggtcagattccagctctcagcgtcttcctgtgatgccgtcg
ccggcgcggggccagttacccttcgtccgattttccaagcaagtggccaactgggctgtgccttacatcgagccgcattttacgcatcctggggctctca
agtgctggacccagatgctgaatgctcggttgcctgccccggtgccccgggatctccgaattatttccagtcctgaaggcatcacagcattcgcggatta
caaaaaattgatcttccgtggaagaagcttcggcggcgactcccgtctcaaacgtgtctttttgacacttcagagttcgatcccgactccaaggtgtccc
agcgggcttcgccgatgactcgggtgatgggatattggagcaattttcgttgtagcggcgacttggacaacgtcgaccttggtttctcgctttgggagcg
tgatcactggatccttccgaaggccgtggagactacgttctccgcagttgctgctgacttggacatgatggactggactgccgcgcggaagactcggacg
aggaaagacttggatgctttgaaagctgcctggtccaggtacgtggtcgagcgcaacaaacgcagcgaccgcctccgcgccaaggtggccccgtacatct
gaaagtggggcagcagccaggatccgggtttctcggggctgaaacccgagttcatgcttgagccgaccatgcccgggtattctctggagtacttgccttg
ggagcccaagactgtcgactggttgagcgaggtcgcggccctggatgctgcggagccttggcggaacggctggatcgatgtgccggagcagcacccctac
aaaactacgttcgtcccgtgcaacccgtcggctccgctcttcgtcccggctggttcttcgcgcgccgatgttggtcgtcgagtcgttcccagttcgtcgc
tgcagccgggtgaattgagcccacaatgggtggccgagtttggtgatgctcgtgttcctgccgcgtctgagtcttcgccgaatgctgcgtcagttctggg
aggacaagctccggatgctgctggtggctccgacgactcgagtctgcttggtgtgttggctcgggcagttgttgcc