Description :
From Genome Similarity Track
Location :
Scaffold_97:295431- 303203
Sequence
7772 bases(100 bases per row)
ACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTCCGAAGT
TCGATGCCATGGATAGGAACGACTTCTCCCATATGATCGACTCTCAGTTCGAGTTGGTTCGGAAGATGGCAGGCTTCTTCGGGATGGAGGCCCTGCAGAG
CCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCT
CCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGTCGTATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAG
AAGTAGAGCTCGCGATGGACGTGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCCTTTGCACTCTCCAGCCTTAGCGGCCGTGCTAAGAGTTGGGTGTA
CACACGAGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGATCAGCTCCGAGCCGCTTTCCTCCCGGCGGACTACGAGTACCGCCAG
CGTTCGCGCTTCCTCTCGTGTAAACAAGGGAGGCGTGAGCTGCACGAGTATGTGCAAGAGATACAGGAGCTCACGGCGTCCCTAGTGGGAAACCCACTCA
ACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCACCGCACGCACATAACAGTTCCGGGTGCAGTCAAACGCCCTTGAAGAGGCGAT
TCAGGTGGCTCTTCAAAAAGAGTACAGTCATCGCCGGGCGCGTACGCCGGTCTCAGCATGGCCTGGGAGCTCCTTGTCGGCTCCCGGTCGAACAAGCCCC
AGCGGACCAGCTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGCAGGAAGATGGGCCACTTCAAGCGCGACTATCCCGCGA
AAAGACTCCGCAGACGGTCCTTCCGCAAGCCCGTCCTCAAGGGTCGCTAACAGAAGCCAGGATCCCGGGGACAGGGGAACGCCGCGAACCAGTAGGGGCG
GGGCGCCCTACTGGGGAAGAACTAAGTCTTCGCGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGG
CGAAGAGCAGCGGCGGGTTGCTCATAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATCGGCTCTGGGGCGTCGAAGAATTTCGC
ACGCCGCCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGACAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAG
GTCGTCACTGTCTCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATTTGATA
TGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGTGAGGCAAGTCAATCGGTGCCAGCCGCCCTGCGCAGTCAGATAGGACATT
GGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGACGCCCGCAAGGGCTGCCAGGGTACCAAAGCATCCGGCAGGTGCTTGGGAGTCGTCGACGTATTT
GACGACTCCGAGGATGTTTTGATGGTGGCCGCGCCCATAAAAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGACAG
CTGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACA
CGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACCATAGTACCA
CACGAGGCCACGAGTACCTCGGATGTCGGAGCGCCGACATCCCCAGACGTGGGTAGCAAAGCTCCACGTCACGGTCGCCGTCGTCAACGACGCCGCCGCC
GCCTCAAGTCGGATCCGAACTTCGTTCCGATCAGCGTCGCTTCAAGCGACTCGGAGTCCAGGGCCTGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTG
TCAGGGCCCGAACTCCTCCGACAAGGCCGGTGGAAGAGTGGCGTCGTTGCCGACATCCCCAGACGTGGGTAGCAAAGCTCCACGTCACGGTCGCCGTCGT
CAACGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCAGCGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGC
CGGTGGAAGAGTGTTGTCACATCTTCGATGGCGAGACCGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACT
GAACCTCGAGGAAATGACGGCTGAGTCTTTCCTGACGAACCTCAAGGCTGGAGAGATTGCTGAGATGTTACTCATGAGACCTGAGACCACTCGGGAGGAG
CTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACCTGAACAAGCAGCGTCAGACGCGCTTGGGTTCTGAGATCGTTAAGAACCCCAAGGATT
CGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGCACAAGATTGATCTCGTG
CCCGGCGCAAAGTATTGTGTCACGAGGCGATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGG
TGCGGGAGTCGAAATCCCCGCACTCGACGCCAACTTTCTGCGCTCGAAGCCGAACGGAAAGTGGCGTCTAGTTCATGCTTATAACAAGCTGAACAACGCG
ACGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGAATACT
TCCAAATCCTGATGCGAGAGAGCGACATCCCCGCTCACCGCGGTGATCACTCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCACAGGGCTTGGCTAA
CGCCCCGGCGACGTTCAAGCGTCTGGTAACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCC
GAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTAATGCGAGCAAACAAGCTGTACGCCAACATCGACAAATGCG
TTTTCGCGTCACCAGAGATTAAAGTTCTCCGTTGCTTCGTAAACAACGTGGGCGTTCGGGCTGACCCAGACAAGGCAAGGCCATAGCAGCATGGCCGACG
CCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCC
TCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGTACCATGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGACCCCTGTCCTGGCCCTGCC
GGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGTGCATTGCTGCAGGCCGACACGGCTGGACATGAACGAGTCATC
TCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAACGGAACTACCCTGTCCACGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTTCGTGTTC
ACCTTCTGGGCTCTAGACCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCT
GTCCTTTTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTATCGGCGTCCTGACTATGAGTTGGCC
CACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCATATCGGGACGACGAGGCTGTCGCGCCTATCGTCAAGTTCCTTATGGCCGGAA
CGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCGCTATTACCGGGTGGAGCCCACTGA
TCCTCCACGGGTGGTCGTACCCAACAAGGAGGATCTGAAGTTCGATATCCTCGCGGAGGCGAATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAG
ACCTTTCTGTCAGCCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCTTGTACGTTAAGACATGCGAAACATGTCAGCGGGTCAAACCCC
GCAGGGCACTCTTCGGCTCCACTACAGAGTCTGCCCGTACCGGCTGACTGTTGGAAGTCGATGGGTCTTGACTTCATCTTTGGGCTTTTCGCCGACGGAC
ACGGCAACACCGGAATTTTGGTGTTCGTGTGACGGCTGAGCAAGATGGTACATCTTGCTCCAGCTCCCGTCACTGGCGAACAAACCGCAAGGTTGTTCGT
CGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTG
GGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGACGGTCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCG
CGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTACACGCGTCCACGGGGCTTACGCTGTTCTACTTGAA
CGGCTTCCGCCACCCCAGAGTGCCTCTCACACTTCAAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGGCTCGGAAACCTTTTCCTCCCAGGTCTCG
GATGTGAGACCAGTTTCGCTGCGGATACAGGTGGAATCCTTTATGGATACCAATCTGAGCATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAGG
ATAAACAAAAAGAGTACTCCGACAAACATGGAAGAGGAAACTTAAGTGTATTTAAAGGGGGGGGGACTTAGTGTTACTAGACACGAGGAACCTACCTCTT
GACACTGTCAGCTCTGTCGGCAGCAGCAAGCTGAAGCACCACTTCATCAGACCATTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTC
CAAAGTCAATGACGACGCACCCGACGTTCTATGTTGGACGTCTTAGGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGACCCAGC
TCCTCGAAGCGAGGGACGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCTGGACGGCAAAGCTGCGGTCAAGACCGTACGCCG
GAGGGGCTCCATACGAACGGACCCTGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTATGCACCATACGCGTACGTCTGGGAGTGTACCGCAGGCGG
CTCCGGACGTGGCAACAAAGCCTCGATCCGTCGAATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTC
GCGACCTCTCGCTCCAACAGGTCTAGGCTGCCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCGGTCCCAAGGCCAA
GTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGTCCTGTGTTGGACCCGCAGTCGGATCACCCGGACGAGAGTGGCTCTCGGG
AGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACG
GTGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAGCTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAG
GCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTTCGGGGCTTCTTGCCCGAACGGGGTACGGACGATGAATACATTCCGTACCCGCG
CTCATCGTTAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATGCGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCC
AGGATGCGGGACAGCAGCAGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGAGTACTTAAGAGTCCCCTACCATGCCCAGAACATTTCCTCACAAGAAC
GCCACGTGGGACAGTTCTCGGGCATAGCCCAGGGGTATCCCCAAAGAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTT
AAGCGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCAACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCC
CTAGAAGTGTGGCCGCCAACAAGGCCACGAGGAGCGACAAAAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGC
TCCCTGGCTGACGGGTGCCACCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAATTCCTCCTGCTGCAGGTCGAGGTCATTCGTGACCTCACGGGGG
TCAGCGATAGCACCCTCCTCCTCCTCTTCTTCCTCCTTCCCCTCCTCTTCATCCGAGGAGTCGAAGATACTCCGATAGGAGTGTTGAGTCTTCTTCTCCT
CGCGGAGTGGAGCCTTAGAGGCTGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCACGCGCAAGATCCCCGGCAAGCGAGAGACG
TTTGCGAGGATTCTCTTCCTCATCGCCACCGGCTTTGGGAGTGCTCTTAGCCTTGACGGCCGGACTCTCAGAGAGCACAGACGGCCTGGGACTGTAATCA
CCTTGGTCACTAGCGAGCGACTGCACGCTGTCATCCTTGTGCTCGCTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCGTGCGTGCTCT
CGGACTCGGCATCGTCCTCACTGCCAGAGTTGAACTCACGTTCCACGAACCGAGGGTTCGGACGATTGTCTGAGGCTGAGGGCGACGGACTGCGGCGCTT
TGCCTGCTCGCTAGCCCACAGCCGCGTCACCCGAGGAACCGATCGCCTCGGAGACCACCTGAGTAGCCTCCTTGAGTGCCGAGCCTTTGCCGTGAGGCTT
AGTGCTCTTGGCTTGCGCCTTTCCGGCAGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTTGCAGTGCCACGAGGCATGGTAACGGTCGAATTGGAGACC
TAGACGAAGAGCGCACAGGTTGCTGCTCGAGACTCTAACTGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGCTTTCGACTTTGAGAATGAGAGT
TTGTGACGAACACCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTAC